TXNL2 (GLRX3) (NM_006541) Human Untagged Clone
CAT#: SC321058
GLRX3 (untagged)-Human glutaredoxin 3 (GLRX3), transcript variant 2
CNY 3,656.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GLRX4; GRX3; GRX4; PICOT; TXNL2; TXNL3 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006541.2
GCTTCTGTCTGGCGGCGGCAGCATGGCGGCGGGGGCGGCTGAGGCAGCTGTAGCGGCCGT
GGAGGAGGTCGGCTCAGCCGGGCAGTTTGAGGAGCTGCTGCGCCTCAAAGCCAAGTCCCT CCTTGTGGTCCATTTCTGGGCACCATGGGCTCCACAGTGTGCACAGATGAACGAAGTTAT GGCAGAGTTAGCTAAAGAACTCCCTCAAGTTTCATTTGTGAAGTTGGAAGCTGAAGGTGT TCCTGAAGTATCTGAAAAATATGAAATTAGCTCTGTTCCCACTTTTCTGTTTTTCAAGAA TTCTCAGAAAATCGACCGATTAGATGGTGCACATGCCCCAGAGTTGACCAAAAAAGTTCA GCGACATGCATCTAGTGGCTCCTTCCTACCCAGCGCTAATGAACATCTTAAAGAAGATCT CAACCTTCGCTTGAAGAAATTGACTCATGCTGCCCCCTGCATGCTGTTTATGAAAGGAAC TCCTCAAGAACCACGCTGTGGTTTCAGCAAGCAGATGGTGGAAATTCTTCACAAACATAA TATTCAGTTTAGCAGTTTTGATATCTTCTCAGATGAAGAGGTTCGACAGGGACTCAAAGC CTATTCCAGTTGGCCTACCTATCCTCAGCTCTATGTTTCTGGAGAGCTCATAGGAGGACT TGATATAATTAAGGAGCTAGAAGCATCTGAAGAACTAGATACAATTTGTCCCAAAGCTCC CAAATTAGAGGAAAGGCTCAAAGTGCTGACAAATAAAGCTTCTGTGATGCTCTTTATGAA AGGAAACAAACAGGAAGCAAAATGTGGATTCAGCAAACAAATTCTGGAAATACTAAATAG TACTGGTGTTGAATATGAAACATTCGATATATTGGAGGATGAAGAAGTTCGGCAAGGATT AAAAGCTTACTCAAATTGGCCAACATACCCTCAGCTGTATGTGAAAGGGGAGCTGGTGGG AGGATTGGATATTGTGAAGGAACTGAAAGAAAATGGTGAATTGCTGCCTATACTGAGAGG AGAAAATTAATAAATCTTAAACTTGGTGCCCAACTATTGTAAGAAATATTTAATTACATT GGGAGCAGTTCATGATTTAGTCCTCAGAAATGGACTAGGAATAGAAAATTCCTGCTTTCT CAGTTACATGTTTTGTGTATTTCACAATGTCGTGCTAAATAAATGTATGTTACATTTTTT TCCCACCAAAAATAGAATGCAATAAACATCTTCAAATTATTAACGAAAAAAAAAAAAAAA AAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006541 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006541.2, NP_006532.2 |
RefSeq Size | 1275 bp |
RefSeq ORF | 1008 bp |
Locus ID | 10539 |
UniProt ID | O76003 |
Domains | thiored |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the glutaredoxin family. Glutaredoxins are oxidoreductase enzymes that reduce a variety of substrates using glutathione as a cofactor. The encoded protein binds to and modulates the function of protein kinase C theta. The encoded protein may also inhibit apoptosis and play a role in cellular growth, and the expression of this gene may be a marker for cancer. Pseudogenes of this gene are located on the short arm of chromosomes 6 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202731 | GLRX3 (Myc-DDK-tagged)-Human glutaredoxin 3 (GLRX3), transcript variant 2 |
CNY 3,656.00 |
|
RC202731L1 | Lenti ORF clone of Human glutaredoxin 3 (GLRX3), transcript variant 2, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC202731L2 | Lenti ORF clone of Human glutaredoxin 3 (GLRX3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC202731L3 | Lenti ORF clone of Human glutaredoxin 3 (GLRX3), transcript variant 2, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC202731L4 | Lenti ORF clone of Human glutaredoxin 3 (GLRX3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG202731 | GLRX3 (tGFP-tagged) - Human glutaredoxin 3 (GLRX3), transcript variant 2 |
CNY 5,256.00 |
|
SC108544 | GLRX3 (untagged)-Human glutaredoxin 3 (GLRX3), transcript variant 2 |
CNY 3,656.00 |