United States
Germany
Japan
United Kingdom
China
DIPK1A (NM_001006605) Human Untagged Clone
CAT＃: SC321024
FAM69A (untagged)-Human family with sequence similarity 69, member A (FAM69A)
CNY 1,800.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FAM69A |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001006605.1
AGCGCGGCGGGGCGATGTGTGATTACCATGGCGAGGAGTCTCTGTCCGGGGGCCTGGCTA
AGGAAACCCTATTACCTCCAGGCTCGCTTCTCATATGTGCGGATGAAATATCTTTTCTTT TCCTGGTTAGTGGTTTTTGTTGGAAGCTGGATTATATATGTGCAGTATTCTACCTATACA GAATTATGCAGAGGAAAGGACTGTAAGAAAATAATATGTGACAAGTACAAGACTGGAGTT ATTGATGGGCCTGCATGTAACAGCCTTTGTGTTACAGAAACTCTTTACTTTGGAAAATGT TTATCCACCAAGCCCAACAATCAGATGTATTTAGGGATTTGGGATAATCTACCAGGTGTT GTGAAATGTCAAATGGAACAAGCGCTTCATCTTGATTTTGGAACTGAATTGGAACCAAGA AAAGAAATAGTGCTATTTGATAAGCCAACTAGAGGAACTACTGTACAAAAATTTAAAGAA ATGGTCTATAGTCTCTTTAAGGACCAGCACCGGTAATTGTGCCAAACTTTTGCGAAGCAC TGCTCCAGACAGCAATCAGTGATGCCAAACGTCGGTTTGTTCGGAACACGCTATGTCCCA CTTCGAAAACCTAGCCTCAAATAACAACTACGTACCTCTCGAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001006605 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001006605.1, NP_001006606.1 |
| RefSeq Size | 671 bp |
| RefSeq ORF | 489 bp |
| Locus ID | 388650 |
| UniProt ID | Q5T7M9 |
| Protein Families | Transmembrane |
| Gene Summary | This gene encodes a member of the FAM69 family of cysteine-rich type II transmembrane proteins. These proteins localize to the endoplasmic reticulum but their specific functions are unknown. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210015 | FAM69A (Myc-DDK-tagged)-Human family with sequence similarity 69, member A (FAM69A) |
CNY 5,488.00 |
|
| RC210015L3 | Lenti-ORF clone of FAM69A (Myc-DDK-tagged)-Human family with sequence similarity 69, member A (FAM69A) |
CNY 5,890.00 |
|
| RC210015L4 | Lenti-ORF clone of FAM69A (mGFP-tagged)-Human family with sequence similarity 69, member A (FAM69A) |
CNY 5,890.00 |
|
| RG210015 | FAM69A (tGFP-tagged) - Human family with sequence similarity 69, member A (FAM69A) |
CNY 7,088.00 |
|
| SC301068 | FAM69A (untagged)-Human family with sequence similarity 69, member A (FAM69A) |
CNY 6,840.00 |
|
| SC317690 | FAM69A (untagged)-Human family with sequence similarity 69, member A (FAM69A) |
CNY 5,856.00 |
