ORAI1 (NM_032790) Human Untagged Clone
CAT#: SC321019
ORAI1 (untagged)-Human ORAI calcium release-activated calcium modulator 1 (ORAI1)
CNY 3,600.00
Cited in 7 publications. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CRACM1; IMD9; ORAT1; TAM2; TMEM142A |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_032790.2
GCCGCCCGGGGGCTTTTGCCAGCGGCGCCGCGGGCCTGCGTGCTGGGGCAGCGGGCACTT
CTTCGACCTCGTCCTCCTCGTCCTGTGCGGCCGGCCGGGTGAGGCCGGGCCCGCGTAGGG GGCAGTCGGCGGCTGCCTCCGGCGGAGGTGCCTCGCGGCGCCCGGGCCGGCCCGCGCCTC GGCGGCGTGCTCCATGCATCCGGAGCCCGCCCCGCCCCCGAGCCGCAGCAGTCCCGAGCT TCCCCCAAGCGGCGGCAGCACCACCAGCGGCAGCCGCCGGAGCCGCCGCCGCAGCGGGGA CGGGGAGCCCCCGGGGGCCCCGCCACCGCCGCCGTCCGCCGTCACCTACCCGGACTGGAT CGGCCAGAGTTACTCCGAGGTGATGAGCCTCAACGAGCACTCCATGCAGGCGCTGTCCTG GCGCAAGCTCTACTTGAGCCGCGCCAAGCTTAAAGCCTCCAGCCGGACCTCGGCTCTGCT CTCCGGCTTCGCCATGGTGGCAATGGTGGAGGTGCAGCTGGACGCTGACCACGACTACCC ACCGGGGCTGCTCATCGCCTTCAGTGCCTGCACCACAGTGCTGGTGGCTGTGCACCTGTT TGCGCTCATGATCAGCACCTGCATCCTGCCCAACATCGAGGCGGTGAGCAACGTGCACAA TCTCAACTCGGTCAAGGAGTCCCCCCATGAGCGCATGCACCGCCACATCGAGCTGGCCTG GGCCTTCTCCACCGTCATCGGCACGCTGCTCTTCCTAGCTGAGGTGGTGCTGCTCTGCTG GGTCAAGTTCTTGCCCCTCAAGAAGCAGCCAGGCCAGCCAAGGCCCACCAGCAAGCCCCC CGCCAGTGGCGCAGCAGCCAACGTCAGCACCAGCGGCATCACCCCGGGCCAGGCAGCTGC CATCGCCTCGACCACCATCATGGTGCCCTTCGGCCTGATCTTTATCGTCTTCGCCGTCCA CTTCTACCGCTCACTGGTTAGCCATAAGACCGACCGACAGTTCCAGGAGCTCAACGAGCT GGCGGAGTTTGCCCGCTTACAGGACCAGCTGGACCACAGAGGGGACCACCCCCTGACGCC CGGCAGCCACTATGCCTAGGCCCATGTGGTCTGGGCCCTTCCAGTGCTTTGGCCTTACGC CCTTCCCCTTGACCTTGTCCTGCCCCAGCCTCACGGACAGCCTGCGCAGGGGGCTGGGCT TCAGCAAGGGGCAGAGCGTGGAGGGAAGAGGATTTTTATAAGAGAAATTTCTGCACTTTG AAACTGTCCTCTAAGAGAATAAGCATTTCCTGTTCTTCCAGCTCCAGGTCCACCTCCTGT TGGGAGGCGGTGGGGGGCCAAAGTGGGGCCACACACTCGCTGTGTCCCCTCTCCTCCCCT GTGCCAGTGCCACCTGGGTGCCTCCTCCTGTCCTGTCCGTCTCAACCTCCCTCCCGTCCA GCATTGAGTGTGTACATGTGTGTGTGACACATAAATATACTCATAAGGACAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_032790 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_032790.2, NP_116179.2 |
RefSeq Size | 1497 bp |
RefSeq ORF | 906 bp |
Locus ID | 84876 |
UniProt ID | Q96D31 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a membrane calcium channel subunit that is activated by the calcium sensor STIM1 when calcium stores are depleted. This type of channel is the primary way for calcium influx into T-cells. Defects in this gene are a cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 1 (IDTICED1). [provided by RefSeq, Sep 2011] |
Citations (7)
The use of this cDNA Clones has been cited in the following citations: |
---|
Rai1 haploinsufficiency causes reduced Bdnf expression resulting in hyperphagia, obesity and altered fat distribution in mice and humans with no evidence of metabolic syndrome
,Brooke Burns, Kristie Schmidt, Stephen R. Williams, Sun Kim, Santhosh Girirajan, and Sarah H. Elsea,
Hum. Mol. Genet., Aug 2010; 10.1093/hmg/ddq317
[ORAI1]
|
TRPC channels function independently of STIM1 and Orai1
,Wayne I. DeHaven, Bertina F. Jones, John G. Petranka, Jeremy T. Smyth, Takuro Tomita, Gary S. Bird, and James W. Putney, Jr,
J. Physiol., May 2009; 587: 2275 - 2298.
[Orai1]
|
Store-dependent and -independent Modes Regulating Ca2+ Release-activated Ca2+ Channel Activity of Human Orai1 and Orai3
,Shenyuan L. Zhang, J. Ashot Kozak, Weihua Jiang, Andriy V. Yeromin, Jing Chen, Ying Yu, Aubin Penna, Wei Shen, Victor Chi, and Michael D. Cahalan,
J. Biol. Chem., Jun 2008; 283: 17662 - 17671.
[ORAI1]
|
Canonical Transient Receptor Potential 5 Channel in Conjunction with Orai1 and STIM1 Allows Sr2+ Entry, Optimal Influx of Ca2+, and Degranulation in a Rat Mast Cell Line
,Hong-Tao Ma, Ze Peng, Takaaki Hiragun, Shoko Iwaki, Alasdair M. Gilfillan, and Michael A. Beaven,
J. Immunol., Feb 2008; 180: 2233 - 2239.
[Orai1]
|
Orai proteins interact with TRPC channels and confer responsiveness to store depletion
,Y Liao, C Erxleben, E Yildirim, J Abramowitz, DL Armstrong, and L Birnbaumer,
Proc Natl Acad Sci U S A. 2007 Mar 13;104(11):4682-7.
[ORAI1]
|
Large Store-operated Calcium Selective Currents Due to Co-expression of Orai1 or Orai2 with the Intracellular Calcium Sensor, Stim1
,Jason C. Mercer, Wayne I. DeHaven, Jeremy T. Smyth, Barbara Wedel, Rebecca R. Boyles, Gary S. Bird, and James W. Putney, Jr,
J. Biol. Chem., 2006 Aug 25;281(34):24979-90.
[ORAI1]
|
Orai1 and STIM Reconstitute Store-operated Calcium Channel Function
,Jonathan Soboloff, Maria A. Spassova, Xiang D. Tang, Thamara Hewavitharana, Wen Xu, and Donald L. Gill,
J. Biol. Chem., Jul 2006; 281: 20661-20665.
[ORAI1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210034 | ORAI1 (Myc-DDK-tagged)-Human ORAI calcium release-activated calcium modulator 1 (ORAI1) |
CNY 3,600.00 |
|
RC210034L1 | Lenti ORF clone of Human ORAI calcium release-activated calcium modulator 1 (ORAI1), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC210034L2 | Lenti ORF clone of Human ORAI calcium release-activated calcium modulator 1 (ORAI1), mGFP tagged |
CNY 6,000.00 |
|
RC210034L3 | Lenti ORF clone of Human ORAI calcium release-activated calcium modulator 1 (ORAI1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210034L4 | Lenti ORF clone of Human ORAI calcium release-activated calcium modulator 1 (ORAI1), mGFP tagged |
CNY 6,000.00 |
|
RG210034 | ORAI1 (tGFP-tagged) - Human ORAI calcium release-activated calcium modulator 1 (ORAI1) |
CNY 5,200.00 |
|
SC316298 | ORAI1 (untagged)-Human ORAI calcium release-activated calcium modulator 1 (ORAI1) |
CNY 3,600.00 |