PSMD7 (NM_002811) Human Untagged Clone
CAT#: SC320876
PSMD7 (untagged)-Human proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (PSMD7)
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MOV34; P40; Rpn8; S12 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002811.3
GGGGCGAGGGCTGACGAACCGGAAGAAGAGGAACTGGGCCTGAAAGGGTACCGGTGACCG
CTACTGCTGCCGGTGTTTGCGTGTGGCAGGGAGCCAGGCCTGGCGAGCGGGGTGTGTCGC GATGCCGGAGCTGGCAGTGCAGAAGGTGGTGGTCCACCCCCTGGTGCTGCTCAGTGTGGT GGATCATTTCAACCGAATCGGCAAGGTTGGAAACCAGAAGCGTGTTGTTGGTGTGCTTTT GGGGTCATGGCAAAAGAAAGTACTTGATGTATCGAACAGTTTTGCAGTTCCTTTTGATGA AGATGACAAAGACGATTCTGTATGGTTTTTAGACCATGATTATTTGGAAAACATGTATGG AATGTTTAAGAAAGTCAATGCCAGGGAAAGAATAGTTGGCTGGTACCACACAGGCCCTAA ACTACACAAGAATGACATTGCCATCAACGAACTCATGAAAAGATACTGTCCTAATTCCGT ATTGGTCATCATTGATGTGAAGCCGAAGGACCTAGGGCTGCCTACAGAAGCGTACATTTC AGTGGAAGAAGTCCATGATGATGGAACTCCAACCTCGAAAACATTTGAACACGTGACCAG TGAAATTGGAGCAGAGGAAGCTGAGGAAGTTGGAGTTGAACACTTGTTACGAGATATCAA AGACACGACGGTGGGCACTCTGTCCCAGCGGATCACAAACCAGGTCCATGGTTTGAAGGG ACTGAACTCCAAGCTTCTGGATATCAGGAGCTACCTGGAAAAAGTCGCCACAGGCAAGCT GCCCATCAACCACCAGATCATCTACCAGCTGCAGGACGTCTTCAACCTGCTGCCAGATGT CAGCCTGCAGGAGTTCGTCAAGGCCTTTTACCTGAAGACCAATGACCAGATGGTGGTAGT GTACTTGGCCTCGCTGATCCGTTCCGTGGTCGCCCTGCACAACCTCATCAACAACAAGAT TGCCAACCGGGATGCAGAGAAGAAAGAAGGGCAGGAGAAAGAAGAGAGCAAAAAGGATAG GAAAGAGGACAAGGAGAAAGATAAAGATAAGGAAAAGAGTGATGTAAAGAAAGAGGAGAA AAAGGAGAAAAAGTAAAACATGTATTAAATAGCTTTTTTAATTTGTAAATTAAAATCTTA CAAACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002811 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002811.3, NP_002802.2 |
RefSeq Size | 1678 bp |
RefSeq ORF | 975 bp |
Locus ID | 5713 |
UniProt ID | P51665 |
Domains | JAB_MPN |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Proteasome |
Gene Summary | The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 17. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203133 | PSMD7 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (PSMD7) |
CNY 2,400.00 |
|
RC203133L3 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (PSMD7), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203133L4 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (PSMD7), mGFP tagged |
CNY 5,890.00 |
|
RG203133 | PSMD7 (tGFP-tagged) - Human proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (PSMD7) |
CNY 4,000.00 |
|
SC118382 | PSMD7 (untagged)-Human proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (PSMD7) |
CNY 2,400.00 |