United States
Germany
Japan
United Kingdom
China
FKBP14 (NM_017946) Human Untagged Clone
CAT＃: SC320824
FKBP14 (untagged)-Human FK506 binding protein 14, 22 kDa (FKBP14)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | EDSKMH; EDSKSCL2; FKBP22; IPBP12 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_017946.2
AGGTTCGTGACCCTTGAGAAAAGAGTTGGTGGTAAATGTGCCACGTCTTCTAAGAAGGGG
GAGTCCTGAACTTGTCTGAAGCCCTTGTCCGTAAGCCTTGAACTACGTTCTTAAATCTAT GAAGTCGAGGGACCTTTCGCTGCTTTTGTAGGGACTTCTTTCCTTGCTTCAGCAACATGA GGCTTTTCTTGTGGAACGCGGTCTTGACTCTGTTCGTCACTTCTTTGATTGGGGCTTTGA TCCCTGAACCAGAAGTGAAAATTGAAGTTCTCCAGAAGCCATTCATCTGCCATCGCAAGA CCAAAGGAGGGGATTTGATGTTGGTCCACTATGAAGGCTACTTAGAAAAGGACGGCTCCT TATTTCACTCCACTCACAAACATAACAATGGTCAGCCCATTTGGTTTACCCTGGGCATCC TGGAGGCTCTCAAAGGTTGGGACCAGGGCTTGAAAGGAATGTGTGTAGGAGAGAAGAGAA AGCTCATCATTCCTCCTGCTCTGGGCTATGGAAAAGAAGGAAAAGGTAAAATTCCCCCAG AAAGTACACTGATATTTAATATTGATCTCCTGGAGATTCGAAATGGACCAAGATCCCATG AATCATTCCAAGAAATGGATCTTAATGATGACTGGAAACTCTCTAAAGATGAGGTTAAAG CATATTTAAAGAAGGAGTTTGAAAAACATGGTGCGGTGGTGAATGAAAGTCATCATGATG CTTTGGTGGAGGATATTTTTGATAAAGAAGATGAAGACAAAGATGGGTTTATATCTGCCA GAGAATTTACATATAAACACGATGAGTTATAGAGATACATCTACCCTTTTAATATAGCAC TCATCTTTCAAGAGAGGGCAGTCATCTTTAAAGAACATTTTATTTTTATACAATGTTCTT TCTTGCTTTGTTTTTTATTTTTATATATTTTTTCTGACTCCTATTTAAAGAACCCCTTAG GTTTCTAAGTACCCATTTCTTTCTGATAAGTTATTGGGAAGAAAAAGCTAATTGGTCTTT GAATAGAAGACTTCTGGACAATTTTTCACTTTCACAGATATGAAGCTTTGTTTTACTTTC TCACTTATAAATTTAAAATGTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_017946 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_017946.2, NP_060416.1 |
| RefSeq Size | 2247 bp |
| RefSeq ORF | 636 bp |
| Locus ID | 55033 |
| UniProt ID | Q9NWM8 |
| Domains | FKBP, EFh |
| Protein Families | Druggable Genome |
| Gene Summary | The protein encoded by this gene is a member of the FK506-binding protein family of peptidyl-prolyl cis-trans isomerases. The encoded protein is found in the lumen of the endoplasmic reticulum, where it is thought to accelerate protein folding. Defects in this gene are a cause of a type of Ehlers-Danlos syndrome (EDS). Both a protein-coding variant and noncoding variants are transcribed from this gene. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (1) represents the protein-coding transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202674 | FKBP14 (Myc-DDK-tagged)-Human FK506 binding protein 14, 22 kDa (FKBP14) |
CNY 3,600.00 |
|
| RC202674L3 | Lenti ORF clone of Human FK506 binding protein 14, 22 kDa (FKBP14), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202674L4 | Lenti ORF clone of Human FK506 binding protein 14, 22 kDa (FKBP14), mGFP tagged |
CNY 5,890.00 |
|
| RG202674 | FKBP14 (tGFP-tagged) - Human FK506 binding protein 14, 22 kDa (FKBP14) |
CNY 5,200.00 |
|
| SC108712 | FKBP14 (untagged)-Human FK506 binding protein 14, 22 kDa (FKBP14) |
CNY 3,600.00 |
