UBE2C (NM_181801) Human Untagged Clone
CAT#: SC320726
UBE2C (untagged)-Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | dJ447F3.2; UBCH10 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_181801.1
GTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAAACCG
CGACCCAGCCGCCACTAGCGTCGCCGCCGCCCGTAAAGGAGCTGAGCCGAGCGGGGGCGC CGCCCGGGGTCCGGTGGGCAAAAGGCTACAGCAGGAGCTGATGACCCTCATGATGTCTGG CGATAAAGGGATTTCTGCCTTCCCTGAATCAGACAACCTTTTCAAATGGGTAGGGACCAT CCATGGAGCAGCTGGAACAGTATATGAAGACCTGAGGTATAAGCTCTCGCTAGAGTTCCC CAGTGGCTACCCTTACAATGCGCCCACAGTGAAGTTCCTCACGCCCTGCTATCACCCCAA CGTGGACACCCAGGGTAACATATGCCTGGACATCCTGAAGGAAAAGTGGTCTGCCCTGTA TGATGTCAGGACCATTCTGCTCTCCATCCAGAGCCTTCTAGGAGAACCCAACATTGATAG TCCCTTGAACACACATGCTGCCGAGCTCTGGAAAAACCCCACAGCTTTTAAGAAGTACCT GCAAGAAACCTACTCAAAGCAGGTCACCAGCCAGGAGCCCTGACCCAGGCTGCCCAGCCT GTCCTTGTGTCGTCTTTTTAATTTTTCCTTAGATGGTCTGTCCTTTTTGTGATTTCTGTA TAGGACTCTTTATCTTGAGCTGTGGTATTTTTGTTTTGTTTTTGTCTTTTAAATTAAGCC TCGGTTGAGCCCTTGTATATTAAATAAATGCATTTTTGTCCTTTTTTAGACAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_181801 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_181801.1, NP_861517.1 |
RefSeq Size | 936 bp |
RefSeq ORF | 423 bp |
Locus ID | 11065 |
UniProt ID | O00762 |
Protein Families | Druggable Genome |
Protein Pathways | Ubiquitin mediated proteolysis |
Gene Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is required for the destruction of mitotic cyclins and for cell cycle progression, and may be involved in cancer progression. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been defined on chromosomes 4, 14, 15, 18, and 19. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (4) has an alternate 5'-terminal exon and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200240 | UBE2C (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4 |
CNY 2,400.00 |
|
RC200240L3 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200240L4 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
RG200240 | UBE2C (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4 |
CNY 4,000.00 |
|
SC309619 | UBE2C (untagged)-Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4 |
CNY 3,990.00 |