UQCRH (NM_006004) Human Untagged Clone
CAT#: SC320697
UQCRH (untagged)-Human ubiquinol-cytochrome c reductase hinge protein (UQCRH), nuclear gene encoding mitochondrial protein
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | QCR6; UQCR8 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006004.2
CTGAACTGGGTTAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAACCGTAGCCAGACA
TGGGACTGGAGGACGAGCAAAAGATGCTTACCGAATCCGGAGATCCTGAGGAGGAGGAAG AGGAAGAGGAGGAATTAGTGGATCCCCTAACAACAGTGAGAGAGCAATGCGAGCAGTTGG AGAAATGTGTAAAGGCCCGGGAGCGGCTAGAGCTCTGTGATGAGCGTGTATCCTCTCGAT CACATACAGAAGAGGATTGCACGGAGGAGCTCTTTGACTTCTTGCATGCGAGGGACCATT GCGTGGCCCACAAACTCTTTAACAACTTGAAATAAATGTGTGGACTTAATTCACCCCAGT CTTCATCATCTGGGCATCAGAATATTTCCTTATGGTTTTGGATGTACCATTTGTTTCTTA TTTGTGTAACTGTAAGTTCACATGAACCTCATGGGTTTGGCTTAGGCTGGTAGCTTCTAT GTAATTCGCAATGATTCCATCTAAATAAAAGTTCTATGATCTGCAAAAAAAAAAAAAAAA AAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006004 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006004.2, NP_005995.2 |
RefSeq Size | 546 bp |
RefSeq ORF | 276 bp |
Locus ID | 7388 |
UniProt ID | P07919 |
Domains | UCR_hinge |
Protein Families | Druggable Genome |
Protein Pathways | Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201258 | UQCRH (Myc-DDK-tagged)-Human ubiquinol-cytochrome c reductase hinge protein (UQCRH), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
RC201258L1 | Lenti ORF clone of Human ubiquinol-cytochrome c reductase hinge protein (UQCRH), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC201258L2 | Lenti ORF clone of Human ubiquinol-cytochrome c reductase hinge protein (UQCRH), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RC201258L3 | Lenti ORF clone of Human ubiquinol-cytochrome c reductase hinge protein (UQCRH), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201258L4 | Lenti ORF clone of Human ubiquinol-cytochrome c reductase hinge protein (UQCRH), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG201258 | UQCRH (tGFP-tagged) - Human ubiquinol-cytochrome c reductase hinge protein (UQCRH), nuclear gene encoding mitochondrial protein |
CNY 2,800.00 |
|
SC108564 | UQCRH (untagged)-Human ubiquinol-cytochrome c reductase hinge protein (UQCRH), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |