TMEM208 (NM_014187) Human Untagged Clone
CAT#: SC320622
TMEM208 (untagged)-Human transmembrane protein 208 (TMEM208)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hSND2; HSPC171 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_014187.2
GAGCTGCCGATGTGGTGCTTAGTGATTGCGGTTTCGGTCGCTCTCCCGTGTTTCCCGGGC
TGGGTATTTGCCTCGCACCATGGCGCCCAAGGGCAAAGTGGGCACGAGAGGGAAGAAGCA GATATTTGAAGAGAACAGAGAGACTCTGAAGTTCTACCTGCGGATCATACTGGGGGCCAA TGCCATTTACTGCCTTGTGACGTTGGTCTTCTTTTACTCATCTGCCTCATTTTGGGCCTG GTTGGCCCTGGGCTTTAGTCTGGCAGTGTATGGGGCCAGCTACCACTCTATGAGCTCGAT GGCACGAGCAGCGTTCTCTGAGGATGGGGCCCTGATGGATGGTGGCATGGACCTCAACAT GGAGCAGGGCATGGCAGAGCACCTTAAGGATGTGATCCTACTGACAGCCATCGTGCAGGT GCTCAGCTGCTTCTCTCTCTATGTCTGGTCCTTCTGGCTTCTGGCTCCAGGCCGGGCCCT TTACCTCCTGTGGGTGAATGTGCTGGGCCCCTGGTTCACTGCAGACAGTGGCACCCCAGC ACCAGAGCACAATGAGAAACGGCAGCGCCGACAGGAGCGGCGGCAGATGAAGCGGTTATA GCCATTGACATTGTGGCCACAGGCCACTGGCCCTGGGTGGCTCTGTCAGGGTGCACAGCC CCTCATGCCTGGAGCAATGAGGGTCTAGTCCAGGGGCCAAAAGCAGTCTGAGGTATTGGG TATACTTATACTCTATAGGGTCGTTGAATAAATGGCTTAGAATGTGAAAAAAAAAAAAAA AAAA |
Restriction Sites | Please inquire |
ACCN | NM_014187 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014187.2, NP_054906.2 |
RefSeq Size | 784 bp |
RefSeq ORF | 522 bp |
Locus ID | 29100 |
UniProt ID | Q9BTX3 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a highly conserved protein which is localized in the endoplasmic reticulum (ER). The protein is linked to autophagy and ER stress. Knockdown of this gene increased autophagy and triggered ER stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200049 | TMEM208 (Myc-DDK-tagged)-Human transmembrane protein 208 (TMEM208) |
CNY 2,400.00 |
|
RC200049L3 | Lenti ORF clone of Human transmembrane protein 208 (TMEM208), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200049L4 | Lenti ORF clone of Human transmembrane protein 208 (TMEM208), mGFP tagged |
CNY 5,890.00 |
|
RG200049 | TMEM208 (tGFP-tagged) - Human transmembrane protein 208 (TMEM208) |
CNY 4,000.00 |
|
SC127526 | TMEM208 (untagged)-Human transmembrane protein 208 (TMEM208) |
CNY 3,990.00 |
|
SC317271 | TMEM208 (untagged)-Human transmembrane protein 208 (TMEM208) |
CNY 3,990.00 |
其它TMEM208产品