United States
Germany
Japan
United Kingdom
China
RPL7A (NM_000972) Human Untagged Clone
CAT＃: SC320508
RPL7A (untagged)-Human ribosomal protein L7a (RPL7A)
CNY 2,400.00
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | L7A; SURF3; TRUP |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_000972.2
AGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTCTCTCTCCTCCCGCCGCCCAA
GATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCCGGCCCCAGCTGTCGTGAA GAAGCAGGAGGCTAAGAAAGTGGTGAATCCCCTGTTTGAGAAAAGGCCTAAGAATTTTGG CATTGGACAGGACATCCAGCCCAAAAGAGACCTCACCCGCTTTGTGAAATGGCCCCGCTA TATCAGGTTGCAGCGGCAGAGAGCCATCCTCTATAAGCGGCTGAAAGTGCCTCCTGCGAT TAACCAGTTCACCCAGGCCCTGGACCGCCAAACAGCTACTCAGCTGCTTAAGCTGGCCCA CAAGTACAGACCAGAGACAAAGCAAGAGAAGAAGCAGAGACTGTTGGCCCGGGCCGAGAA GAAGGCTGCTGGCAAAGGGGACGTCCCAACGAAGAGACCACCTGTCCTTCGAGCAGGAGT TAACACCGTCACCACCTTGGTGGAGAACAAGAAAGCTCAGCTGGTGGTGATTGCACACGA CGTGGATCCCATCGAGCTGGTTGTCTTCTTGCCTGCCCTGTGTCGTAAAATGGGGGTCCC TTACTGCATTATCAAGGGAAAGGCAAGACTGGGACGTCTAGTCCACAGGAAGACCTGCAC CACTGTCGCCTTCACACAGGTGAACTCGGAAGACAAAGGCGCTTTGGCTAAGCTGGTGGA AGCTATCAGGACCAATTACAATGACAGATACGATGAGATCCGCCGTCACTGGGGTGGCAA TGTCCTGGGTCCTAAGTCTGTGGCTCGTATCGCCAAGCTCGAAAAGGCAAAGGCTAAAGA ACTTGCCACTAAACTGGGTTAAATGTACACTGTTGAGTTTTCTGTACATAAAAATAATTG AAATAATACAAATTTTCCTTCAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_000972 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000972.2, NP_000963.1 |
| RefSeq Size | 890 bp |
| RefSeq ORF | 801 bp |
| Locus ID | 6130 |
| UniProt ID | P62424 |
| Domains | Ribosomal_L7Ae |
| Protein Families | Druggable Genome |
| Protein Pathways | Ribosome |
| Gene Summary | Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L7AE family of ribosomal proteins. It can interact with a subclass of nuclear hormone receptors, including thyroid hormone receptor, and inhibit their ability to transactivate by preventing their binding to their DNA response elements. This gene is included in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity. It is co-transcribed with the U24, U36a, U36b, and U36c small nucleolar RNA genes, which are located in its second, fifth, fourth, and sixth introns, respectively. This gene rearranges with the trk proto-oncogene to form the chimeric oncogene trk-2h, which encodes an oncoprotein consisting of the N terminus of ribosomal protein L7a fused to the receptor tyrosine kinase domain of trk. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204917 | RPL7A (Myc-DDK-tagged)-Human ribosomal protein L7a (RPL7A) |
CNY 2,400.00 |
|
| RC204917L1 | Lenti ORF clone of Human ribosomal protein L7a (RPL7A), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC204917L2 | Lenti ORF clone of Human ribosomal protein L7a (RPL7A), mGFP tagged |
CNY 5,890.00 |
|
| RC204917L3 | Lenti ORF clone of Human ribosomal protein L7a (RPL7A), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC204917L4 | Lenti ORF clone of Human ribosomal protein L7a (RPL7A), mGFP tagged |
CNY 5,890.00 |
|
| RG204917 | RPL7A (tGFP-tagged) - Human ribosomal protein L7a (RPL7A) |
CNY 4,000.00 |
|
| SC119574 | RPL7A (untagged)-Human ribosomal protein L7a (RPL7A) |
CNY 2,400.00 |
