SLC25A3 (NM_002635) Human Untagged Clone
CAT#: SC320327
SLC25A3 (untagged)-Human solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 (SLC25A3), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 3,656.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | OK/SW-cl.48; PHC; PTP |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002635.2
GCAACCTTTCCAAGGGAGTGGTTGTGTGATCGCCATCTTAGGGAAAAGATGTTCTCGTCC
GTGGCGCACCTGGCGCGGGCGAACCCCTTCAACACGCCACATCTGCAGCTGGTGCACGAT GGTCTCGGGGACCTCCGCAGCAGCTCCCCAGGGCCCACGGGCCAGCCCCGCCGCCCTCGC AACCTGGCAGCCGCCGCCGTGGAAGAGTACAGTTGTGAATTTGGCTCCGCGAAGTATTAT GCACTGTGTGGCTTTGGTGGGGTCTTAAGTTGTGGTCTGACACACACTGCTGTGGTTCCC CTGGATTTAGTGAAATGCCGTATGCAGGTGGACCCCCAAAAGTACAAGGGCATATTTAAC GGATTCTCAGTTACACTTAAAGAGGATGGTGTTCGTGGTTTGGCTAAAGGATGGGCTCCG ACTTTCCTTGGCTACTCCATGCAGGGACTCTGCAAGTTTGGCTTTTATGAAGTCTTTAAA GTCTTGTATAGCAATATGCTTGGAGAGGAGAATACTTATCTCTGGCGCACATCACTATAT TTGGCTGCCTCTGCCAGTGCTGAATTCTTTGCTGACATTGCCCTGGCTCCTATGGAAGCT GCTAAGGTTCGAATTCAAACCCAGCCAGGTTATGCCAACACTTTGAGGGATGCAGCTCCC AAAATGTATAAGGAAGAAGGCCTAAAAGCATTCTACAAGGGGGTTGCTCCTCTCTGGATG AGACAGATACCATACACCATGATGAAGTTCGCCTGCTTTGAACGTACTGTTGAAGCACTG TACAAGTTTGTGGTTCCTAAGCCCCGCAGTGAATGTTCAAAGCCAGAGCAGCTGGTTGTA ACATTTGTAGCAGGTTACATAGCTGGAGTCTTTTGTGCAATTGTTTCTCACCCTGCTGAT TCTGTGGTATCTGTGTTGAATAAAGAAAAAGGTAGCAGTGCTTCTCTGGTCCTCAAGAGA CTTGGATTTAAAGGTGTATGGAAGGGACTGTTTGCCCGTATCATCATGATTGGTACCCTG ACTGCACTACAGTGGTTTATCTATGACTCCGTGAAGGTCTACTTCAGACTTCCTCGCCCT CCTCCACCCGAGATGCCAGAGTCTCTGAAGAAGAAGCTTGGGTTAACTCAGTAGTTAGAT CAAAGCAAATGTGGACTGAATCTGCTTGTTGATCAGTGTTGAAGAAAGTGCAAAAGGAAC TTTTATATATTTGACAGTGTAGGAAATTGTCTATTCCTGATATAATTACTGTAGTACTCT TGCTTAAGGCAAGAGTTTCAGATTTACTGTTGAAATAAACCCAACTCTTCATGAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002635 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002635.2, NP_002626.1 |
RefSeq Size | 1685 bp |
RefSeq ORF | 1086 bp |
Locus ID | 5250 |
UniProt ID | Q00325 |
Domains | mito_carr |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene catalyzes the transport of phosphate into the mitochondrial matrix, either by proton cotransport or in exchange for hydroxyl ions. The protein contains three related segments arranged in tandem which are related to those found in other characterized members of the mitochondrial carrier family. Both the N-terminal and C-terminal regions of this protein protrude toward the cytosol. Multiple alternatively spliced transcript variants have been isolated. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) represents the predominant transcript. Variants 2 and 3 encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202942 | SLC25A3 (Myc-DDK-tagged)-Human solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 (SLC25A3), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,656.00 |
|
RC202942L3 | Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 (SLC25A3), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202942L4 | Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 (SLC25A3), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG202942 | SLC25A3 (tGFP-tagged) - Human solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 (SLC25A3), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,256.00 |
|
SC118480 | SLC25A3 (untagged)-Human solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 (SLC25A3), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,656.00 |
其它SLC25A3产品