United States
Germany
Japan
United Kingdom
China
ITGB3BP (NM_014288) Human Untagged Clone
CAT＃: SC320275
ITGB3BP (untagged)-Human integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), transcript variant 2
CNY 2,400.00
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CENP-R; CENPR; HSU37139; NRIF3; TAP20 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_014288.3
CTGGGTTCGTTTTATTCAGCGGCAGTGGTGCTTTCCCGAATCTCAGAATGCCTGTTAAAA
GATCACTGAAGTTGGATGGTCTGTTAGAAGAAAATTCATTTGATCCTTCAAAAATCACAA GGAAGAAAAGTGTTATAACTTATTCTCCAACAACTGGAACTTGTCAAATGAGTCTATTTG CTTCTCCCACAAGTTCTGAAGAGCAAAAGCACAGAAATGGACTATCAAATGAAAAGAGAA AAAAATTGAATCACCCCAGTTTAACTGAAAGCAAAGAATCTACAACAAAAGACAATGATG AATTCATGATGTTGCTATCAAAAGTTGAGAAATTGTCAGAAGAAATCATGGAGATAATGC AAAATTTAAGTAGTATACAGGCTTTGGAGGGCAGTAGAGAGCTTGAAAATCTCATTGGAA TCTCCTGTGCATCACATTTCTTAAAAAGAGAAATGCAGAAAACCAAAGAACTAATGACAA AAGTGAATAAACAAAAACTGTTTGAAAAGAGTACAGGACTTCCTCACAAAGCATCACGTC ATCTTGACAGCTATGAATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCA CTCACCATGAGCACCAACTTCTGCATCTGCCTGATCATATTTAAAGGAACAGAGAAATAT TTGTAATTAATCTGCCCAGTAAATACCAGCTCGTAGCAGTTGGCAGGTGCATGTCTAGAT AAAATTTCTTGCAGCTAATTTAAACTTTCTACACGCACCAGTAGATAATCTCAATGTAAA TAATACATTTCTTCTTGGCTCTTTAATGTAAGCCAACATGGAGAGGAAGATCTTGACTTA TATTCTGTACCACATACACTTCTGTGGACTTTTAGCATTTGTGGGTAGACTTAATAAAGC ATGTATAAAAGTGAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_014288 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_014288.3, NP_055103.3 |
| RefSeq Size | 892 bp |
| RefSeq ORF | 534 bp |
| Locus ID | 23421 |
| UniProt ID | Q13352 |
| Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
| Gene Summary | This gene encodes a transcriptional coregulator that binds to and enhances the activity of members of the nuclear receptor families, thyroid hormone receptors and retinoid X receptors. This protein also acts as a corepressor of NF-kappaB-dependent signaling. This protein induces apoptosis in breast cancer cells through a caspase 2-mediated signaling pathway. This protein is also a component of the centromere-specific histone H3 variant nucleosome associated complex (CENP-NAC) and may be involved in mitotic progression by recruiting the histone H3 variant CENP-A to the centromere. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. Isoform 2 is shorter, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200064 | ITGB3BP (Myc-DDK-tagged)-Human integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), transcript variant 2 |
CNY 2,400.00 |
|
| RC200064L1 | Lenti ORF clone of Human integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200064L2 | Lenti ORF clone of Human integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC200064L3 | Lenti ORF clone of Human integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200064L4 | Lenti ORF clone of Human integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG200064 | ITGB3BP (tGFP-tagged) - Human integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), transcript variant 2 |
CNY 4,000.00 |
其它ITGB3BP产品
