AKR1C4 (NM_001818) Human Untagged Clone
CAT#: SC319841
AKR1C4 (untagged)-Human aldo-keto reductase family 1, member C4 (chlordecone reductase, 3-alpha hydroxysteroid dehydrogenase, type I, dihydrodiol dehydrogenase 4) (AKR1C4)
CNY 2,400.00
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 3-alpha-HSD; C11; CDR; CHDR; DD-4; DD4; HAKRA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001818.2
ACAGGATCTGCTTAGTGAAAGAAGTGGCAAGCAATGGATCCCAAATATCAGCGTGTAGAG
CTAAATGATGGTCACTTCATGCCCGTATTGGGATTTGGCACCTATGCACCTCCAGAGGTT CCGAGGAACAGAGCTGTAGAGGTCACCAAATTAGCAATAGAAGCTGGCTTCCGCCATATT GATTCTGCTTATTTATACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAGATT GCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAGCTTTGGTGCACTTTC TTTCAACCACAGATGGTCCAACCAGCCTTGGAAAGCTCACTGAAAAAACTTCAACTGGAC TATGTTGACCTCTATCTTCTTCATTTCCCAATGGCTCTCAAGCCAGGTGAGACGCCACTA CCAAAAGATGAAAATGGAAAAGTAATATTCGACACAGTGGATCTCTCTGCCACATGGGAG GTCATGGAGAAGTGTAAGGATGCAGGATTGGCCAAGTCCATCGGGGTGTCAAACTTCAAC TACAGGCAGCTGGAGATGATCCTCAACAAGCCAGGACTCAAGTACAAGCCTGTCTGCAAC CAGGTAGAATGTCATCCTTACCTCAACCAGAGCAAACTGCTGGATTTCTGCAAGTCAAAA GACATTGTTCTGGTTGCCCACAGTGCTCTGGGAACCCAACGACATAAACTATGGGTGGAC CCAAACTCCCCAGTTCTTTTGGAGGACCCAGTTCTTTGTGCCTTAGCAAAGAAACACAAA CGAACCCCAGCCCTGATTGCCCTGCGCTACCAGCTGCAGCGTGGGGTTGTGGTCCTGGCC AAGAGCTACAATGAGCAGCGGATCAGAGAGAACATCCAGGTTTTTGAATTCCAGTTGACA TCAGAGGATATGAAAGTTCTAGATGGTCTAAACAGAAATTATCGATATGTTGTCATGGAT TTTCTTATGGACCATCCTGATTATCCATTTTCAGATGAATATTAGCATAGAGGGTGTTGC ACGACATCTAGCAGAAGGCCCTGTGTGTGGATGGTGATGCAGAGGATGTCTCTATGCTGG TGACTGGACACACGGCCTCTGGTTAAATCCCTCCCCTCCTGCTTGGCAACTTCAGCTAGC TAGATATATCCATGGTCCAGAAAGCAAACATAATAAATTTTTATCTTGAACTAAAAAAAA AAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001818 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001818.2, NP_001809.2 |
RefSeq Size | 1194 bp |
RefSeq ORF | 972 bp |
Locus ID | 1109 |
UniProt ID | P17516 |
Protein Families | Druggable Genome |
Protein Pathways | Androgen and estrogen metabolism, C21-Steroid hormone metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Primary bile acid biosynthesis |
Gene Summary | This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the bioreduction of chlordecone, a toxic organochlorine pesticide, to chlordecone alcohol in liver. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204731 | AKR1C4 (Myc-DDK-tagged)-Human aldo-keto reductase family 1, member C4 (chlordecone reductase, 3-alpha hydroxysteroid dehydrogenase, type I, dihydrodiol dehydrogenase 4) (AKR1C4) |
CNY 2,400.00 |
|
RC204731L3 | Lenti ORF clone of Human aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4) (AKR1C4), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204731L4 | Lenti ORF clone of Human aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4) (AKR1C4), mGFP tagged |
CNY 4,800.00 |
|
RG204731 | AKR1C4 (tGFP-tagged) - Human aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4) (AKR1C4) |
CNY 4,000.00 |