CD16b (FCGR3B) (NM_000570) Human Untagged Clone
CAT#: SC319729
FCGR3B (untagged)-Human Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B)
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD16; CD16A; CD16b; FCG3; FCGR3; FCGR3A; FCR-10; FCRIII; FCRIIIb |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_000570 edited
AAGCAGTGGTATCAACGCAGAGTGCCCATTACGGCCGGGGGTGGCATCATGTGGCAGCTG CTCCTCCCAACTGCTCTGCTACTTCTAGTTTCAGCTGGCATGCGGACTGAAGATCTCCCA AAGGCTGTGGTGTTCCTGGAGCCTCAATGGTACAGGGTGCTCGAGAAGGACAGTGTGACT CTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACACAGTGGTTTCACAATGAG AGCCTCATCTCAAGCCAGGCCTCGAGCTACTTCATTGACGCTGCCACAGTCGACGACAGT GGAGAGTACAGGTGCCAGACAAACCTCTCCACCCTCAGTGACCCGGTGCAGCTAGAAGTC CATATCGGCTGGCTGTTGCTCCAGGCCCCTCGGTGGGTGTTCAAGGAGGAAGACCCTATT CACCTGAGGTGTCACAGCTGGAAGAACACTGCTCTGCATAAGGTCACATATTTACAGAAT GGCAAAGGCAGGAAGTATTTTCATCATAATTCTGACTTCTACATTCCAAAAGCCACACTC AAAGACAGCGGCTCCTACTTCTGCAGGGGGCTTGTTGGGAGTAAAAATGTGTCTTCAGAG ACTGTGAACATCACCATCACTCAAGGTTTGGCAGTGTCAACCATCTCATCATTCTTTCCA CCTGGGTACCAAGTCTCTTTCTGCTTGGTGATGGTACTCCTTTTTGCAGTGGACACAGGA CTATATTTCTCTGTGAAGACAAACATTTGAAGCTCAACAAGAGACTGGAAGGACCATAAA TTTAAATGGAGAAAGGACCCTCAAGACAAATGACCCCCATCCCATGGGGGTAATAAGAGC AGTAGCAGCAGCATCTCTGAACATTTCTCTGGATTTGCAACCCTATCATCCTCAGGCCTC TCTACAAGCAGCAGGAAACATAGAACTCAGAGCCAGATCCCTTATCCAACTCTCGACTTT TCCTTGGTCTCCAGTGGAAGGGAAAAGCCCATGATCTTCAAGCAGGGAAGCCCCAGTGAG TAGCTGCATTCCTAGAAATTGAAGTTTCAGAGCTACACAAACACTTTTTCTGTCCCAACC GTTCCCTCACAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-XhoI |
ACCN | NM_000570 |
Insert Size | 1100 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000570.3, NP_000561.3 |
RefSeq Size | 2300 bp |
RefSeq ORF | 702 bp |
Locus ID | 2215 |
UniProt ID | O75015 |
Domains | ig |
Protein Families | ES Cell Differentiation/IPS, Secreted Protein, Transmembrane |
Protein Pathways | Natural killer cell mediated cytotoxicity, Systemic lupus erythematosus |
Gene Summary | The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204749 | FCGR3B (Myc-DDK-tagged)-Human Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B) |
CNY 3,600.00 |
|
RC204749L1 | Lenti-ORF clone of FCGR3B (Myc-DDK-tagged)-Human Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B) |
CNY 6,000.00 |
|
RC204749L2 | Lenti-ORF clone of FCGR3B (mGFP-tagged)-Human Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B) |
CNY 5,890.00 |
|
RC204749L3 | Lenti-ORF clone of FCGR3B (Myc-DDK-tagged)-Human Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B) |
CNY 5,890.00 |
|
RC204749L4 | Lenti-ORF clone of FCGR3B (mGFP-tagged)-Human Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B) |
CNY 6,000.00 |
|
RG204749 | FCGR3B (tGFP-tagged) - Human Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B) |
CNY 5,200.00 |