United States
Germany
Japan
United Kingdom
China
PREI3 (MOB4) (NM_199482) Human Untagged Clone
CAT＃: SC319677
MOB4 (untagged)-Human MOB1, Mps One Binder kinase activator-like 3 (yeast) (MOBKL3), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2C4D; CGI-95; MOB1; MOB3; MOBKL3; PHOCN; PREI3 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_199482.1
CCCTACATCCGGGTACCGACTCCAGCCGCCTAGACGCTGGCACTATGGTCATGGCGGAGG
GGACGGCAGTGCTGAGGCGGAACAGGCCGGGCACCAAGGCGCAGGATTTCTATAATTGGC CTGATGAATCCTTTGATGAAATGGACAGTACACTAGCTGTTCAACAGTATATTCAACAGA ACATAAGAGCAGATTGCTCCAATATTGACAAAATTCTTGAACCACCTGAAGGCCAAGATG AAGGTGTGTGGAAGTATGAACATTTAAGGCAGTTCTGCCTTGAGCTAAATGGACTTGCTG TCAAACTTCAGAGTGAATGCCATCCAGATACTTGCACTCAAATGACAGCAACTGAACAAT GGATTTTTCTTTGTGCAGCTCATAAAACTCCAAAAGAGTGTCCTGCTATAGACTATACTA GACACACACTTGATGGTGCTGCATGTCTTCTGAATAGCAATAAATATTTTCCCAGCAGGG TTAGCATAAAGGAATCATCTGTAGCGAAACTAGGATCAGTATGCCGTAGGATTTACAGAA TATTTTCACATGCTTATTTTCATCATCGGCAGATATTTGATGAATATGAAAATGAAACAT TTTTGTGTCATCGGTTTACTAAGTTTGTGATGAAATACAATTTGATGTCCAAGGATAACC TGATTGTACCAATTTTAGAAGAGGAAGTACAGAATTCAGTTTCTGGGGAAAGTGAAGCAT GAAGGGAATCATAGGAAAAATGTACTGATCATATAATTAACATTATGTACTGTATATATC ATTTTAGACACATCAATCATGTATCCATATTATAGCTTCTTTGTTTAGTATAGGTTTTTG TATGCTGGGTTTGCCTTTTAAAATGGGAAATACTTTTTAAGTTATTCATAAGCTGTATAT TCACCAGTGTGGCACTCATGGTTTTTAAATAAGATTAGTATTATCTGTTTATAATGCCTG TTAATAAAAGAATTTACAGTTTGATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_199482 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_199482.1, NP_955776.1 |
| RefSeq Size | 2698 bp |
| RefSeq ORF | 582 bp |
| Locus ID | 25843 |
| UniProt ID | Q9Y3A3 |
| Gene Summary | This gene was identified based on its similarity with the mouse counterpart. Studies of the mouse counterpart suggest that the expression of this gene may be regulated during oocyte maturation and preimplantation following zygotic gene activation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HSPE1.[provided by RefSeq, Feb 2011] Transcript Variant: This variant (2) uses an alternate exon at its 5' end compared to variant 1, resulting in a different 5' UTR and translation initiation at a downstream start codon. The resulting isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 4 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202689 | MOB4 (Myc-DDK-tagged)-Human MOB1, Mps One Binder kinase activator-like 3 (yeast) (MOBKL3), transcript variant 2 |
CNY 2,400.00 |
|
| RC202689L3 | Lenti ORF clone of Human MOB1, Mps One Binder kinase activator-like 3 (yeast) (MOBKL3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202689L4 | Lenti ORF clone of Human MOB1, Mps One Binder kinase activator-like 3 (yeast) (MOBKL3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG202689 | MOB4 (tGFP-tagged) - Human MOB1, Mps One Binder kinase activator-like 3 (yeast) (MOBKL3), transcript variant 2 |
CNY 4,370.00 |
