Endo G (ENDOG) (NM_004435) Human Untagged Clone
CAT#: SC319651
ENDOG (untagged)-Human endonuclease G (ENDOG), nuclear gene encoding mitochondrial protein
CNY 2,400.00
CNY 2,950.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004435.2
GGGGAAATGCGCAAAGAAAGGACGCCGGGGACACCCGGTTGGGCTCTGCTGCTCCCTTCT
GGGTTCCGAGGCCCAAGCCCTTGGCAGTGTTTGTGAGTGGAAGGGAGGTCACGCTATCGT CCGCGGCCCCAGCAGCCCTGTGCCCTCGTTGGATCCCGCGACGCGGCTCCTTTAAGAGCC TCGCGGGTCGCCCGCCGCTAGGTCGCTCCCCGGCCATGCGGGCGCTGCGGGCCGGCCTGA CCCTGGCGTTGGGCGCGGGGCTGGGTGCGGTCGTCGAGGGCTGGCGGCGGCGGCGGGAGG ACGCGCGGGCGGCGCCGGGACTGCTGGGCCGGCTGCCCGTGCTGCCCGTGGCGGCGGCAG CCGAGTTGCCCCCTGTGCCCGGGGGACCCCGCGGCCCGGGCGAGCTGGCCAAGTACGGGC TGCCGGGGCTGGCGCAGCTCAAGAGCCGCGAGTCGTACGTGCTGTGCTACGACCCGCGCA CCCGCGGCGCGCTCTGGGTGGTGGAGCAGCTGCGACCCGAGCGTCTCCGCGGCGACGGCG ACCGGCGCGAGTGCGACTTCCGCGAGGACGACTCGGTGCACGCGTACCACCGTGCCACCA ACGCCGACTACCGCGGCAGTGGCTTCGACCGCGGTCACCTGGCCGCCGCCGCCAACCACC GCTGGAGCCAGAAGGCCATGGACGACACGTTCTACCTGAGCAACGTCGCGCCCCAGGTGC CCCACCTCAACCAGAATGCCTGGAACAACCTGGAGAAATATAGCCGCAGCTTGACCCGCA GCTACCAAAACGTCTATGTCTGCACAGGGCCACTCTTCCTGCCCAGGACAGAGGCTGATG GGAAATCCTACGTAAAGTACCAGGTCATCGGCAAGAACCACGTGGCAGTGCCCACACACT TCTTCAAGGTGCTGATCCTGGAGGCAGCAGGTGGGCAAATTGAGCTCCGCACCTACGTGA TGCCCAACGCACCTGTGGATGAGGCCATCCCACTGGAGCGCTTCCTGGTGCCCATCGAGA GCATTGAGCGGGCTTCGGGGCTGCTCTTTGTGCCAAACATCCTGGCGCGGGCAGGCAGCC TCAAGGCCATCACGGCGGGCAGTAAGTGAGGGTGGAGCCCAGTGAGACTGTGGGTGTGTG CAGGCCGGGGAGTATTAAAGGTGGTGATTTTTGGACAAAAAAAAAAAAAAAAAAAAAAAA AAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004435 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_004435.2, NP_004426.2 |
RefSeq Size | 1145 bp |
RefSeq ORF | 894 bp |
Locus ID | 2021 |
UniProt ID | Q14249 |
Domains | Endonuclease |
Protein Families | Druggable Genome |
Protein Pathways | Apoptosis |
Gene Summary | The protein encoded by this gene is a nuclear encoded endonuclease that is localized in the mitochondrion. The encoded protein is widely distributed among animals and cleaves DNA at GC tracts. This protein is capable of generating the RNA primers required by DNA polymerase gamma to initiate replication of mitochondrial DNA. [provided by RefSeq, Jul 2008] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Caspase-dependent cell death-associated release of nucleosome and damage-associated molecular patterns
,Yoon, S;Park, SJ;Han, JH;Kang, JH;Kim, JH;Lee, J;Park, S;Shin, HJ;Kim, K;Yun, M;Chwae, YJ;,
Cell Death Dis
,PubMed ID 25356863
[ENDOG]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205089 | ENDOG (Myc-DDK-tagged)-Human endonuclease G (ENDOG), nuclear gene encoding mitochondrial protein |
CNY 2,400.00 |
|
RC205089L1 | Lenti ORF clone of Human endonuclease G (ENDOG), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC205089L2 | Lenti ORF clone of Human endonuclease G (ENDOG), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RC205089L3 | Lenti ORF clone of Human endonuclease G (ENDOG), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205089L4 | Lenti ORF clone of Human endonuclease G (ENDOG), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG205089 | ENDOG (tGFP-tagged) - Human endonuclease G (ENDOG), nuclear gene encoding mitochondrial protein |
CNY 4,000.00 |