Claudin 14 (CLDN14) (NM_012130) Human Untagged Clone

CAT#: SC319640

CLDN14 (untagged)-Human claudin 14 (CLDN14), transcript variant 2



  "NM_012130" in other vectors (6)

CNY 2,400.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-CLDN14 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DFNB29
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_012130.2 GTTTGCTTCACCTTCTGCCAGGATTGTAAGTTTCCTGAGGCCTCCCCAGTCCTGCGGAAC
TGGCTCCGGCTGGCACCTGAGGAGCGGCGTGACCCCGAGGGCCCAGGGAGCTGCCCGGCT
GGCCTAGGCAGGCAGCCGCACCATGGCCAGCACGGCCGTGCAGCTTCTGGGCTTCCTGCT
CAGCTTCCTGGGCATGGTGGGCACGTTGATCACCACCATCCTGCCGCACTGGCGGAGGAC
AGCGCACGTGGGCACCAACATCCTCACGGCCGTGTCCTACCTGAAAGGGCTCTGGATGGA
GTGTGTGTGGCACAGCACAGGCATCTACCAGTGCCAGATCTACCGATCCCTGCTGGCGCT
GCCCCAAGACCTCCAGGCTGCCCGCGCCCTCATGGTCATCTCCTGCCTGCTCTCGGGCAT
AGCCTGCGCCTGCGCCGTCATCGGGATGAAGTGCACGCGCTGCGCCAAGGGCACACCCGC
CAAGACCACCTTTGCCATCCTCGGCGGCACCCTCTTCATCCTGGCCGGCCTCCTGTGCAT
GGTGGCCGTCTCCTGGACCACCAACGACGTGGTGCAGAACTTCTACAACCCGCTGCTGCC
CAGCGGCATGAAGTTTGAGATTGGCCAGGCCCTGTACCTGGGCTTCATCTCCTCGTCCCT
CTCGCTCATTGGTGGCACCCTGCTTTGCCTGTCCTGCCAGGACGAGGCACCCTACAGGCC
CTACCAGGCCCCGCCCAGGGCCACCACGACCACTGCAAACACCGCACCTGCCTACCAGCC
ACCAGCTGCCTACAAAGACAATCGGGCCCCCTCAGTGACCTCGGCCACGCACAGCGGGTA
CAGGCTGAACGACTACGTGTGAGTCCCCACAGCCTGCTTCTCCCCTGGGCTGCTGTGGGC
TGGGTCCCCGGCGGGACTGTCAATGGAGGCAGGGGTTCCAGCACAAAGTTTACTTCTGGG
CAATTTTTGTATCCAAGGAAATAATGTGAATGCGAGGAAATGTCTTTAGAGCACAGGGAC
AGAGGGGGAAATAAGAGGAGGAGAAAGCTCTCTATACCAAAGACTGAAAAAAAAAATCCT
GTCTGTTTTTGTATTTATTATATATATTTATGTGGGTGATTTGATAACAAGTTTAATATA
AAGTGACTTGGGAGTTTGGTCAGTGGGGTTGGTTTGTGATCCAGGAATAAACCTTGCGGA
TGTGGCTGTTTATGAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_012130
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_012130.2, NP_036262.1
RefSeq Size 1233 bp
RefSeq ORF 720 bp
Locus ID 23562
UniProt ID O95500
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
Gene Summary Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. The encoded protein also binds specifically to the WW domain of Yes-associated protein. Defects in this gene are the cause of an autosomal recessive form of nonsyndromic sensorineural deafness. It is also reported that four synonymous variants in this gene are associated with kidney stones and reduced bone mineral density. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (epsilon) differs in the 5' UTR compared to variant 1. All five variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...