United States
Germany
Japan
United Kingdom
China
GSTM3 (NM_000849) Human Untagged Clone
CAT＃: SC319401
GSTM3 (untagged)-Human glutathione S-transferase mu 3 (brain) (GSTM3), transcript variant 1
CNY 2,400.00
CNY 2,950.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GST5; GSTB; GSTM3-3; GTM3 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_000849.3
CGGAAGCCCGTCACCATGTCGTGCGAGTCGTCTATGGTTCTCGGGTACTGGGATATTCGT
GGGCTGGCGCACGCCATCCGCCTGCTCCTGGAGTTCACGGATACCTCTTATGAGGAGAAA CGGTACACGTGCGGGGAAGCTCCTGACTATGATCGAAGCCAATGGCTGGATGTGAAATTC AAGCTAGACCTGGACTTTCCTAATCTGCCCTACCTCCTGGATGGGAAGAACAAGATCACC CAGAGCAATGCCATCTTGCGCTACATCGCTCGCAAGCACAACATGTGTGGTGAGACTGAA GAAGAAAAGATTCGAGTGGACATCATAGAGAACCAAGTAATGGATTTCCGCACACAACTG ATAAGGCTCTGTTACAGCTCTGACCACGAAAAACTGAAGCCTCAGTACTTGGAAGAGCTA CCTGGACAACTGAAACAATTCTCCATGTTTCTGGGGAAATTCTCATGGTTTGCCGGGGAA AAGCTCACCTTTGTGGATTTTCTCACCTATGATATCTTGGATCAGAACCGTATATTTGAC CCCAAGTGCCTGGATGAGTTCCCAAACCTGAAGGCTTTCATGTGCCGTTTTGAGGCTTTG GAGAAAATCGCTGCCTACTTACAGTCTGATCAGTTCTGCAAGATGCCCATCAACAACAAG ATGGCCCAGTGGGGCAACAAGCCTGTATGCTGAGCAGGAGGCAGACTTGCAGAGCTTGTT TTGTTTCATCCTGTCCGTAAGGGGTCAGCGCTCTTGCTTTGCTCTTTTCAATGAATAGCA CTTATGTTACTGGTGTCCAGCTGAGTTTCTCTTGGGTATAAAGGCTAAAAGGGAAAAAGG ATATGTGGAGAATCATCAAGATATGAATTGAATCGCTGCGATACTGGCATTTCCCTACTC CCCAACTGAGTTCAAGGGCTGTAGGTTCATGCCCAAGCCCTGAGAGTGGGTACTAGAAAA AACGAGATTGCACAGTTGGAGAGAGCAGGTGTGTTAAATGGGACTGGAGTCCCTGTGAAG ACTGGGTGAGGATAACACAAGTAAAACTGTGGTACTGATGGACTTAACCGGAGTTCGGAA ACCGTCCTGTGTACACATGGGAGTTTAGTGTGATAAAGGCAGTATTTCAGACTGGTGGGC TAGCCAATAGAGTTGGGACAATTGCTTACTCATTAAAAATAATAGAGCCCCACTTGACAC TATTCACTAAAATTAATCTGGAATTTAAGGCCCAACATTAAACACAAAGCTGTTGAAATA AAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_000849 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000849.3, NP_000840.2 |
| RefSeq Size | 3948 bp |
| RefSeq ORF | 678 bp |
| Locus ID | 2947 |
| UniProt ID | P21266 |
| Domains | GST_N, GST_C |
| Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450 |
| Gene Summary | Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Mutations of this class mu gene have been linked with a slight increase in a number of cancers, likely due to exposure with environmental toxins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008] Transcript Variant: This variant (1) represents the longer transcript. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Cytochrome P450-Mediated Bioactivation of Mefenamic Acid to Quinoneimine Intermediates and Inactivation by Human Glutathione S-Transferases
,Venkataraman, H;den Braver, MW;Vermeulen, NP;Commandeur, JN;,
Chem. Res. Toxicol.
,PubMed ID 25372302
[GSTM3]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201013 | GSTM3 (Myc-DDK-tagged)-Human glutathione S-transferase mu 3 (brain) (GSTM3), transcript variant 1 |
CNY 2,400.00 |
|
| RC201013L3 | Lenti ORF clone of Human glutathione S-transferase mu 3 (brain) (GSTM3), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC201013L4 | Lenti ORF clone of Human glutathione S-transferase mu 3 (brain) (GSTM3), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG201013 | GSTM3 (tGFP-tagged) - Human glutathione S-transferase mu 3 (brain) (GSTM3), transcript variant 1 |
CNY 4,000.00 |
