COPS6 (NM_006833) Human Untagged Clone
CAT#: SC319375
COPS6 (untagged)-Human COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6)
CNY 2,400.00
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CSN6; MOV34-34KD |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006833.4
GGAAAATGGCGGCGGCGGCGGCGGCGGCTGCAGCTACGAACGGGACCGGAGGAAGCAGCG
GGATGGAGGTGGATGCAGCAGTAGTCCCCAGCGTGATGGCCTGCGGAGTGACTGGGAGTG TTTCCGTCGCTCTCCATCCCCTTGTCATTCTCAACATCTCAGACCACTGGATCCGCATGC GCTCCCAGGAGGGGCGGCCTGTGCAGGTGATTGGGGCTCTGATTGGCAAGCAGGAGGGCC GAAATATCGAGGTGATGAACTCCTTTGAGCTGCTGTCCCACACCGTGGAAGAGAAGATTA TCATTGACAAGGAATATTATTACACCAAGGAGGAGCAGTTTAAACAGGTGTTCAAGGAGC TGGAGTTTCTGGGTTGGTATACCACAGGGGGGCCACCTGACCCCTCGGACATCCACGTCC ATAAGCAGGTGTGTGAGATCATCGAGAGCCCCCTCTTTCTGAAGTTGAACCCTATGACCA AGCACACAGATCTTCCTGTCAGCGTTTTTGAGTCTGTCATTGATATAATCAATGGAGAGG CCACAATGCTGTTTGCTGAGCTGACCTACACTCTGGCCACAGAGGAAGCGGAACGCATTG GTGTAGACCACGTAGCCCGAATGACAGCAACAGGCAGTGGAGAGAACTCCACTGTGGCTG AACACCTGATAGCACAGCACAGCGCCATCAAGATGCTGCACAGCCGCGTCAAGCTCATCT TGGAGTACGTCAAGGCCTCTGAAGCGGGAGAGGTCCCCTTTAATCATGAGATCCTGCGGG AGGCCTATGCTCTGTGTCACTGTCTCCCGGTGCTCAGCACAGACAAGTTCAAGACAGATT TTTATGATCAATGCAACGACGTGGGGCTCATGGCCTACCTCGGCACCATCACCAAAACGT GCAACACCATGAACCAGTTTGTGAACAAGTTCAATGTCCTCTACGACCGACAAGGCATCG GCAGGAGAATGCGCGGGCTCTTTTTCTGATGAGGGTACTTGAAGGGCTGATGGACAGGGG TCAGGCAACTATCCCAAAGGGGAGGGCACTACACTTCCTTGAGAGAAACCGCTGTCATTA ATAAAAGGGGAGCAGCCCCTGAGCACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006833 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006833.4, NP_006824.2 |
RefSeq Size | 1441 bp |
RefSeq ORF | 984 bp |
Locus ID | 10980 |
UniProt ID | Q7L5N1 |
Domains | JAB_MPN |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Gene Summary | The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein belongs to translation initiation factor 3 (eIF3) superfamily. It is involved in the regulation of cell cycle and likely to be a cellular cofactor for HIV-1 accessory gene product Vpr. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200252 | COPS6 (Myc-DDK-tagged)-Human COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6) |
CNY 2,400.00 |
|
RC200252L3 | Lenti ORF clone of Human COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200252L4 | Lenti ORF clone of Human COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6), mGFP tagged |
CNY 5,890.00 |
|
RG200252 | COPS6 (tGFP-tagged) - Human COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6) |
CNY 4,000.00 |