NME2 (NM_001018139) Human Untagged Clone
CAT#: SC319374
NME2 (untagged)-Human non-metastatic cells 2, protein (NM23B) expressed in (NME2), transcript variant 4
CNY 1,200.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NDKB; NDPK-B; NDPKB; NM23-H2; NM23B; PUF |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001018139.1
GTTCCCTCTTCCGCTTGCGCTGCCGCAGGACCATGGCCAACCTGGAGCGCACCTTCATCG
CCATCAAGCCGGACGGCGTGCAGCGCGGCCTGGTGGGCGAGATCATCAAGCGCTTCGAGC AGAAGGGATTCCGCCTCGTGGCCATGAAGTTCCTCCGGGCCTCTGAAGAACACCTGAAGC AGCACTACATTGACCTGAAAGACCGACCATTCTTCCCTGGGCTGGTGAAGTACATGAACT CAGGGCCGGTTGTGGCCATGGTCTGGGAGGGGCTGAACGTGGTGAAGACAGGCCGAGTGA TGCTTGGGGAGACCAATCCAGCAGATTCAAAGCCAGGCACCATTCGTGGGGACTTCTGCA TTCAGGTTGGCAGGAACATCATTCATGGCAGTGATTCAGTAAAAAGTGCTGAAAAAGAAA TCAGCCTATGGTTTAAGCCTGAAGAACTGGTTGACTACAAGTCTTGTGCTCATGACTGGG TCTATGAATAAGAGGTGGACACAACAGCAGTCTCCTTCAGCACGGCGTGGTGTGTCCCTG GACACAGCTCTTCATTCCATTGACTTAGAGGCAACAGGATTGATCATTCTTTTATAGAGC ATATTTGCCAATAAAGCTTTTGGAAGCCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001018139 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001018139.1, NP_001018149.1 |
RefSeq Size | 702 bp |
RefSeq ORF | 459 bp |
Locus ID | 4831 |
UniProt ID | P22392 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Metabolic pathways, Purine metabolism, Pyrimidine metabolism |
Gene Summary | Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by NME1) and 'B' (encoded by this gene) isoforms. Multiple alternatively spliced transcript variants have been found for this gene. Read-through transcription from the neighboring upstream gene (NME1) generates naturally-occurring transcripts (NME1-NME2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1-4 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200680 | NME2 (Myc-DDK-tagged)-Human non-metastatic cells 2, protein (NM23B) expressed in (NME2), transcript variant 4 |
CNY 1,200.00 |
|
RC200680L3 | Lenti ORF clone of Human non-metastatic cells 2, protein (NM23B) expressed in (NME2), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200680L4 | Lenti ORF clone of Human non-metastatic cells 2, protein (NM23B) expressed in (NME2), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
RG200680 | NME2 (tGFP-tagged) - Human non-metastatic cells 2, protein (NM23B) expressed in (NME2), transcript variant 4 |
CNY 2,800.00 |