DDAH2 (NM_013974) Human Untagged Clone
CAT#: SC319363
DDAH2 (untagged)-Human dimethylarginine dimethylaminohydrolase 2 (DDAH2)
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DDAH; DDAHII; G6a; HEL-S-277; NG30 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_013974.1
CTAAAAGCCAGAGCTCCCAGTCCCCGAGGCTTGAAGACGGGGACTCCCTTCTCCACCAAC
TCTGTCCTCGGGGGGTGGGGCCCCAGCCGAGATCACAGCGCGACAGGAGTGGGGGTGGCC GCTGGAGACAGGTGAAGAAACAAGAAAACTAAGAAATCCGAGCGGTTGGAGGGGGAGTCT GTGTGGATGGGATGGGGACGCCGGGGGAGGGGCTGGGCCGCTGCTCCCATGCCCTGATCC GGGGAGTCCCAGAGAGCCTGGCGTCGGGGGAAGGTGCGGGGGCTGGCCTTCCCGCTCTGG ATCTGGCCAAAGCTCAAAGGGAGCACGGGGTGCTGGGAGGTAAACTGAGGCAACGACTGG GGCTACAGCTGCTAGAACTGCCACCTGAGGAGTCATTGCCGCTGGGACCGCTGCTTGGCG ACACGGCCGTGATCCAAGGGGACACGGCCCTAATCACGCGGCCCTGGAGCCCCGCTCGTA GGCCAGAGGTCGATGGAGTCCGCAAAGCCCTGCAAGACCTGGGGCTCCGAATTGTGGAAA TAGGAGACGAGAACGCGACGCTGGATGGCACTGACGTTCTCTTCACCGGCCGGGAGTTTT TCGTAGGCCTCTCCAAATGGACCAATCACCGAGGAGCTGAGATCGTGGCGGACACGTTCC GGGACTTCGCCGTCTCCACTGTGCCAGTCTCGGGTCCCTCCCACCTGCGCGGTCTCTGCG GCATGGGGGGACCTCGCACTGTTGTGGCAGGCAGCAGCGACGCTGCCCAAAAGGCTGTCC GGGCAATGGCAGTGCTGACAGATCACCCATATGCCTCCCTGACCCTCCCAGATGACGCAG CTGCTGACTGTCTCTTTCTTCGTCCTGGGTTGCCTGGTGTGCCCCCTTTCCTCCTGCACC GTGGAGGTGGGGATCTGCCCAACAGCCAGGAGGCACTGCAGAAGCTCTCTGATGTCACCC TGGTACCTGTGTCCTGCTCAGAACTGGAGAAGGCTGGCGCCGGGCTCAGCTCCCTCTGCT TGGTGCTCAGCACACGCCCCCACAGCTGAGGGCCTGGCCTTGGGGTACTGCTGGCCAGGG GTAGGATAGTATAGGAAGTAGAAGGGGAAGGAGGGTTAGATAGAGAATGCTGAATAGGCA GTAGTTGGGAGAGAGCCTCAATATTGGGGGAGGGGAGAGTGTAGGGAAAAGGATCCACTG GGTGAATCCTCCCTCTCAGAACCAATAAAATAGAATTGACCTTTTAAAAAAAAAAAAAAA AAA |
Restriction Sites | Please inquire |
ACCN | NM_013974 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_013974.1, NP_039268.1 |
RefSeq Size | 1351 bp |
RefSeq ORF | 858 bp |
Locus ID | 23564 |
UniProt ID | O95865 |
Domains | Amidinotransf |
Gene Summary | This gene encodes a dimethylarginine dimethylaminohydrolase. The encoded enzyme functions in nitric oxide generation by regulating the cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. The protein may be localized to the mitochondria. Alternative splicing resulting in multiple transcript variants. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (2) lacks a segment of the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200287 | DDAH2 (Myc-DDK-tagged)-Human dimethylarginine dimethylaminohydrolase 2 (DDAH2) |
CNY 3,600.00 |
|
RC200287L1 | Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 2 (DDAH2), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC200287L2 | Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 2 (DDAH2), mGFP tagged |
CNY 5,890.00 |
|
RC200287L3 | Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 2 (DDAH2), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC200287L4 | Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 2 (DDAH2), mGFP tagged |
CNY 5,890.00 |
|
RG200287 | DDAH2 (tGFP-tagged) - Human dimethylarginine dimethylaminohydrolase 2 (DDAH2) |
CNY 5,200.00 |