United States
Germany
Japan
United Kingdom
China
SKP2 (NM_032637) Human Untagged Clone
CAT＃: SC319362
SKP2 (untagged)-Human S-phase kinase-associated protein 2 (p45) (SKP2), transcript variant 2
CNY 3,656.00
CNY 7,220.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FBL1; FBXL1; FLB1; p45 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_032637.2
CGTTGCTAGGCTTAGCGGGTCTGGCTGCTGGGGGCCCGAGCAGCACGCTCGGAGCCGCCG
CGCGCCAAAGCGGGAATCTGGGAGGCGAGCAGCTCTGCAGTTAATGCACGTATTTTAAAC TCCCGGGCCTGCGGACGCTATGCACAGGAAGCACCTCCAGGAGATTCCAGACCTGAGTAG CAACGTTGCCACCAGCTTCACGTGGGGATGGGATTCCAGCAAGACTTCTGAACTGCTGTC AGGCATGGGGGTCTCCGCCCTGGAGAAAGAGGAGCCCGACAGTGAGAACATCCCCCAGGA ACTGCTCTCAAACCTGGGCCACCCGGAGAGCCCCCCACGGAAACGGCTGAAGAGCAAAGG GAGTGACAAAGACTTTGTGATTGTCCGCAGGCCTAAGCTAAATCGAGAGAACTTTCCAGG TGTTTCATGGGACTCCCTTCCGGATGAGCTGCTCTTGGGAATCTTTTCCTGTCTGTGCCT CCCTGAGCTGCTAAAGGTCTCTGGTGTTTGTAAGAGGTGGTATCGCCTAGCGTCTGATGA GTCTCTATGGCAGACCTTAGACCTCACAGGTAAAAATCTGCACCCGGATGTGACTGGTCG GTTGCTGTCTCAAGGGGTGATTGCCTTCCGCTGCCCACGATCATTTATGGACCAACCATT GGCTGAACATTTCAGCCCTTTTCGTGTACAGCACATGGACCTATCGAACTCAGTTATAGA AGTGTCCACCCTCCACGGCATACTGTCTCAGTGTTCCAAGTTGCAGAATCTAAGCCTGGA AGGCCTGCGGCTTTCGGATCCCATTGTCAATACTCTCGCAAAAAACTCAAATTTAGTGCG ACTTAACCTTTCTGGGTGTTCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAG CTGTTCCAGACTGGATGAGCTGAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGT ACAGGTGGCTGTTGCGCATGTGTCAGAGACCATCACCCAGCTGAATCTTAGCGGCTACAG AAAGAATCTCCAGAAATCAGATCTCTCTACTTTAGTTAGAAGATGCCCCAATCTTGTCCA TCTAGACTTAAGTGATAGTGTCATGCTAAAGAATGACTGCTTTCAGGAATTTTTCCAGCT CAACTACCTCCAACACCTATCACTCAGTCGGTGCTATGATATAATACCTGAAACTTTACT ATTAGTGACAAGAGCTGGGGTTAGGATCCGGTTGGACTCTGACATCGGATGCCCTCAAAC ATACAGAACTTCCAAACTCAAGTCCAGCCATAAGCTATTTTGCCAACATGTCAGAGTAAT CTGTATTTTTGTATGTGATTTCTACTTTTATAGACTTGTTTTAAAACAATAAAACACATT TTTATAAAAATGAGTGCTTAAAAACAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_032637 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_032637.2, NP_116026.1 |
| RefSeq Size | 1462 bp |
| RefSeq ORF | 1233 bp |
| Locus ID | 6502 |
| UniProt ID | Q13309 |
| Domains | LRR, F-box, LRR_CC |
| Protein Families | Druggable Genome |
| Protein Pathways | Acute myeloid leukemia, Apoptosis, Cell cycle, Oocyte meiosis, p53 signaling pathway, Pathways in cancer, Progesterone-mediated oocyte maturation, Small cell lung cancer, Ubiquitin mediated proteolysis |
| Gene Summary | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011] Transcript Variant: This variant (2) uses an alternate splice junction at the 5' end of a coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200294 | SKP2 (Myc-DDK-tagged)-Human S-phase kinase-associated protein 2 (p45) (SKP2), transcript variant 2 |
CNY 4,090.00 |
|
| RC200294L3 | Lenti-ORF clone of SKP2 (Myc-DDK-tagged)-Human S-phase kinase-associated protein 2 (p45) (SKP2), transcript variant 2 |
CNY 5,990.00 |
|
| RC200294L4 | Lenti-ORF clone of SKP2 (mGFP-tagged)-Human S-phase kinase-associated protein 2 (p45) (SKP2), transcript variant 2 |
CNY 6,056.00 |
|
| RG200294 | SKP2 (tGFP-tagged) - Human S-phase kinase-associated protein 2 (p45) (SKP2), transcript variant 2 |
CNY 5,256.00 |
