United States
Germany
Japan
United Kingdom
China
PEAMT (PEMT) (NM_148173) Human Untagged Clone
CAT＃: SC319360
PEMT (untagged)-Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 3
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PEAMT; PEMPT; PEMT2; PLMT; PNMT |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_148173.1
GGGGCGCGTGGCTGCAGCGGGGCCCGCGTGGTGCCTCCTGAGGCGGCCCCCGGATGAAGA
GATCTGGGAACCCGGGAGCCGAGGTAACGAACAGCTCGGTGGCAGGGCCTGACTGCTGCG GAGGCCTCGGCAATATTGATTTTAGACAGGCAGACTTCTGCGTTATGACCCGGCTGCTGG GCTACGTGGACCCCCTGGATCCCAGCTTTGTGGCTGCCGTCATCACCATCACCTTCAATC CGCTCTACTGGAATGTGGTTGCACGATGGGAACACAAGACCCGCAAGCTGAGCAGGGCCT TCGGATCCCCCTACCTGGCCTGCTACTCTCTAAGCATCACCATCCTGCTCCTGAACTTCC TGCGCTCGCACTGCTTCACGCAGGCCATGCTGAGCCAGCCCAGGATGGAGAGCCTGGACA CCCCCGCGGCCTACAGCCTGGGCCTCGCGCTCCTGGGACTGGGCGTCGTGCTCGTGCTCT CCAGCTTCTTTGCACTGGGGTTCGCTGGAACTTTCCTAGGTGATTACTTCGGGATCCTCA AGGAGGCGAGAGTGACCGTGTTCCCCTTCAACATCCTGGACAACCCCATGTACTGGGGAA GCACAGCCAACTACCTGGGCTGGGCCATCATGCACGCCAGCCCCACGGGCCTGCTCCTGA CGGTGCTGGTGGCCCTCACCTACATAATGGCTCTCCTATACGAAGAGCCCTTCACCGCTG AGATCTACCGGCAGAAAGCCTCCGGGTCCCACAAGAGGAGCTGATTGAGCTGCAACAGCT TTGCTGAAGGCCTGGCCAGCCTCCTGGCCTGCCCCAAGTGGCAGGCCCTGCGCAGGGCGA GAATGGTGCCTGCTGCTCAGGGCTCGCCCCCGGCGTGGGCTGCCCCAGTGCCTTGGAACC TGCTGCCTTGGGGACCCTGGACGTGCCGACATATGGCCATTGAGCTCCAACCCACACATT CCCATTCACCAATAAAGGCACCCTGACCCCAAAAAAAAAAAAAATAAAAAAAAAAAAAAA AAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_148173 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_148173.1, NP_680478.1 |
| RefSeq Size | 905 bp |
| RefSeq ORF | 600 bp |
| Locus ID | 10400 |
| UniProt ID | Q9UBM1 |
| Domains | PEMT |
| Protein Families | Transmembrane |
| Protein Pathways | Glycerophospholipid metabolism, Metabolic pathways |
| Gene Summary | Phosphatidylcholine (PC) is the most abundant mammalian phospholipid. This gene encodes an enzyme which converts phosphatidylethanolamine to phosphatidylcholine by sequential methylation in the liver. Another distinct synthetic pathway in nucleated cells converts intracellular choline to phosphatidylcholine by a three-step process. The protein isoforms encoded by this gene localize to the endoplasmic reticulum and mitochondria-associated membranes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2012] Transcript Variant: This variant (3) differs in the 5' UTR and uses a downstream start codon compared to variant 1. Variants 2 and 3 encode the same isoform (2). Isoform 2 localizes to mitochondria-associated membranes. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200787 | PEMT (Myc-DDK-tagged)-Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 2,400.00 |
|
| RC200787L3 | Lenti ORF clone of Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC200787L4 | Lenti ORF clone of Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG200787 | PEMT (tGFP-tagged) - Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 4,000.00 |
