NDUFB7 (NM_004146) Human Untagged Clone
CAT#: SC319354
NDUFB7 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa (NDUFB7), nuclear gene encoding mitochondrial protein
CNY 1,200.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B18; CI-B18 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004146.4
GTGGTTCCGGGTAGGAGCTAGGTGACCCTCGGCTGCTGCAGGGATCTGCAGCGACTGCAG
CCATGGGGGCGCACCTGGTCCGGCGCTACCTGGGCGATGCCTCGGTGGAGCCCGACCCCC TGCAGATGCCAACCTTCCCGCCAGACTACGGCTTCCCCGAACGCAAGGAGCGCGAGATGG TGGCCACACAGCAGGAGATGATGGACGCGCAGCTGAGGCTCCAGCTGCGGGACTACTGCG CCCACCACCTCATCCGGCTGCTCAAGTGCAAGCGTGACAGCTTCCCCAACTTCCTGGCCT GCAAGCAGGAGCGGCACGACTGGGACTACTGCGAGCACCGCGACTATGTGATGCGCATGA AGGAGTTTGAGCGGGAGCGGAGGCTGCTCCAGCGGAAGAAGCGGCGGGAGAAGAAGGCGG CAGAGTTGGCCAAAGGCCAGGGACCCGGGGAAGTGGACCCCAAGGTGGCCCTGTAGGGGG TGCACCCCCCACCCTATGGACCAGTCAAATAAAAGCCTTCAGGCCCCTCAAAAAAAAAAA AAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004146 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_004146.4, NP_004137.2 |
RefSeq Size | 570 bp |
RefSeq ORF | 414 bp |
Locus ID | 4713 |
UniProt ID | P17568 |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It is located at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200784 | NDUFB7 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa (NDUFB7), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
RC200784L3 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa (NDUFB7), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200784L4 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa (NDUFB7), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG200784 | NDUFB7 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa (NDUFB7), nuclear gene encoding mitochondrial protein |
CNY 2,800.00 |