United States
Germany
Japan
United Kingdom
China
TIPRL (NM_001031800) Human Untagged Clone
CAT＃: SC319268
TIPRL (untagged)-Human TIP41, TOR signaling pathway regulator-like (S. cerevisiae) (TIPRL), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | TIP; TIP41; TIPRL1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001031800.1
CCTCTGCGGGTCCTGCCTCAGCCATGATGATCCACGGCTTCCAGAGCAGCCACCGGGATT
TCTGCTTCGGGCCCTGGAAGCTGACGGCGTCCAAGACCCACATCATGAAGTCGGCGGATG TGGAGAAATTAGCCGATGAATTACATATGCCATCTCTCCCTGAAATGATGTTTGGAGACA ACGTTTTAAGAATCCAGCATGGGTCTGGCTTTGGAATTGAGTTCAATGCTACAGATGCGT TAAGATGTGTAAACAACTACCAAGGAATGCTTAAAGTGGCCTGTGCTGAAGAGTGGCAAG AAAGCAGGACGGAGGGTGAACACTCCAAAGAGGTTATTAAACCATATGATTGGACCTATA CAACAGATTATAAGGGAACCTTACTTGGAGAATCTCTTAAGTTAAAGGTTGTACCTACAA CAGATCATATAGATACAGAAAAATTGAAAGCCAGAGAACAGATTAAGTTTTTTGAAGAAG TTCTCCTTTTTGAGGATGAACTTCATGATCATGGAGTTTCAAGCCTGAGTGTGAAGATTC CTGGTGGCGGGCACCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGAAGCGTGAAC CCGGGAGGCGGAGCTTGCAGTGAGCTGAGATCGCACCACTGCACTCCAGCCCTCCAGCCT GGGCGACAGAGCAAGACTCCGTCTCAAAAAAAAAAAAATAAAATAAAATAAAAGAAGTAG AAAACACAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001031800 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001031800.1, NP_001026970.1 |
| RefSeq Size | 854 bp |
| RefSeq ORF | 537 bp |
| Locus ID | 261726 |
| UniProt ID | O75663 |
| Gene Summary | TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A) (see PPP2CA; MIM 176915), PP4 (see PPP4C; MIM 602035), and PP6 (see PPP6C; MIM 612725) (McConnell et al., 2007 [PubMed 17384681]).[supplied by OMIM, Nov 2010] Transcript Variant: This variant (2) lacks several exons, and uses an alternate 3'-terminal exon, compared to variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201185 | TIPRL (Myc-DDK-tagged)-Human TIP41, TOR signaling pathway regulator-like (S. cerevisiae) (TIPRL), transcript variant 2 |
CNY 2,400.00 |
|
| RC201185L3 | Lenti ORF clone of Human TIP41, TOR signaling pathway regulator-like (S. cerevisiae) (TIPRL), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC201185L4 | Lenti ORF clone of Human TIP41, TOR signaling pathway regulator-like (S. cerevisiae) (TIPRL), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG201185 | TIPRL (tGFP-tagged) - Human TIP41, TOR signaling pathway regulator-like (S. cerevisiae) (TIPRL), transcript variant 2 |
CNY 4,370.00 |
