Serum Amyloid P (APCS) (NM_001639) Human Untagged Clone
CAT#: SC319221
APCS (untagged)-Human amyloid P component, serum (APCS)
CNY 2,400.00
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HEL-S-92n; PTX2; SAP |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001639.2
GGGCATGAATATCAGACGCTAGGGGGACAGCCACTGTGTTGTCTGCTACCCTCATCCTGG
TCACTGCTTCTGCTATAACAGCCCTAGGCCAGGAATATGAACAAGCCGCTGCTTTGGATC TCTGTCCTCACCAGCCTCCTGGAAGCCTTTGCTCACACAGACCTCAGTGGGAAGGTGTTT GTATTTCCTAGAGAATCTGTTACTGATCATGTAAACTTGATCACACCGCTGGAGAAGCCT CTACAGAACTTTACCTTGTGTTTTCGAGCCTATAGTGATCTCTCTCGTGCCTACAGCCTC TTCTCCTACAATACCCAAGGCAGGGATAATGAGCTACTAGTTTATAAAGAAAGAGTTGGA GAGTATAGTCTATACATTGGAAGACACAAAGTTACATCCAAAGTTATCGAAAAGTTCCCG GCTCCAGTGCACATCTGTGTGAGCTGGGAGTCCTCATCAGGTATTGCTGAATTTTGGATC AATGGGACACCTTTGGTGAAAAAGGGTCTGCGACAGGGTTACTTTGTGGAAGCTCAGCCC AAGATTGTCCTGGGGCAGGAACAGGATTCCTATGGGGGCAAGTTTGATAGGAGCCAGTCC TTTGTGGGAGAGATTGGGGATTTGTACATGTGGGACTCTGTGCTGCCCCCAGAAAATATC CTGTCTGCCTATCAGGGTACCCCTCTCCCTGCCAATATCCTGGACTGGCAGGCTCTGAAC TATGAAATCAGAGGATATGTCATCATCAAACCCTTGGTGTGGGTCTGAGGTCTTGACTCA ACGAGAGCACTTGAAAATGAAATGACTGTCTAAGAGATCTGGTCAAAGCAACTGGATACT AGATCTTACATCTGCAGCTCTTTCTTCTTTGAATTTCCTATCTGTATGTCTGCCTAATTA AAAAAATATATATTGTATTATGCTACCTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001639 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001639.2, NP_001630.1 |
RefSeq Size | 959 bp |
RefSeq ORF | 672 bp |
Locus ID | 325 |
UniProt ID | P02743 |
Domains | PTX |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202802 | APCS (Myc-DDK-tagged)-Human amyloid P component, serum (APCS) |
CNY 2,400.00 |
|
RC202802L1 | Lenti ORF clone of Human amyloid P component, serum (APCS), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC202802L2 | Lenti ORF clone of Human amyloid P component, serum (APCS), mGFP tagged |
CNY 5,890.00 |
|
RC202802L3 | Lenti ORF clone of Human amyloid P component, serum (APCS), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202802L4 | Lenti ORF clone of Human amyloid P component, serum (APCS), mGFP tagged |
CNY 5,890.00 |
|
RG202802 | APCS (tGFP-tagged) - Human amyloid P component, serum (APCS) |
CNY 4,000.00 |
其它Serum Amyloid P产品