ERAB (HSD17B10) (NM_001037811) Human Untagged Clone
CAT#: SC319196
HSD17B10 (untagged)-Human hydroxysteroid (17-beta) dehydrogenase 10 (HSD17B10), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 17b-HSD10; ABAD; CAMR; DUPXp11.22; ERAB; HADH2; HCD2; HSD10MD; MHBD; MRPP2; MRX17; MRX31; MRXS10; SCHAD; SDR5C1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001037811.2
CCGGCGACAAGATGGCAGCAGCGTGTCGGAGCGTGAAGGGCCTGGTGGCGGTAATAACCG
GAGGAGCCTCGGGCCTGGGCCTGGCCACGGCGGAGCGACTTGTGGGGCAGGGAGCCTCTG CTGTGCTTCTGGACCTGCCCAACTCGGGTGGGGAGGCCCAAGCCAAGAAGTTAGGAAACA ACTGCGTTTTCGCCCCAGCCGACGTGACCTCTGAGAAGGATGTGCAAACAGCTCTGGCTC TAGCAAAAGGAAAGTTTGGCCGTGTGGATGTAGCTGTCAACTGTGCAGGCATCGCGGTGG CTAGCAAGACGTACAACTTAAAGAAGGGCCAGACCCATACCTTGGAAGACTTCCAGCGAG TTCTTGATGTGAATCTCATGGGCACCTTCAATGTGATCCGCCTGGTGGCTGGTGAGATGG GCCAGAATGAACCAGACCAGGGAGGCCAACGTGGGGTCATCATCAACACTGCCAGTGTGG CTGCCTTCGAGGGTCAGGTTGGACAAGCTGCATACTCTGCTTCCAAGGGGGGAATAGTGG GCATGACACTGCCCATTGCTCGGGATCTGGCTCCCATAGGTCTGTTTGGCACCCCACTGC TGACCAGCCTCCCAGAGAAAGTGTGCAACTTCTTGGCCAGCCAAGTGCCCTTCCCTAGCC GACTGGGTGACCCTGCTGAGTATGCTCACCTCGTACAGGCCATCATCGAGAACCCATTCC TCAATGGAGAGGTCATCCGGCTGGATGGGGCCATTCGTATGCAGCCTTGAAGGGAGAAGG CAGAGAAAACACACGCTCCTCTGCCCTTCCTTTCCCTGGGGTACTACTCTCCAGCTTGGG AGGAAGCCCAGTAGCCATTTTGTAACTGCCTACCAGTCGCCCTCTGTGCCTAATAAAGTC TCTTTTTCTCACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAC |
Restriction Sites | Please inquire |
ACCN | NM_001037811 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001037811.2, NP_001032900.1 |
RefSeq Size | 936 bp |
RefSeq ORF | 759 bp |
Locus ID | 3028 |
UniProt ID | Q99714 |
Protein Families | Druggable Genome |
Protein Pathways | Alzheimer's disease, Metabolic pathways, Valine, leucine and isoleucine degradation |
Gene Summary | This gene encodes 3-hydroxyacyl-CoA dehydrogenase type II, a member of the short-chain dehydrogenase/reductase superfamily. The gene product is a mitochondrial protein that catalyzes the oxidation of a wide variety of fatty acids and steroids, and is a subunit of mitochondrial ribonuclease P, which is involved in tRNA maturation. The protein has been implicated in the development of Alzheimer disease, and mutations in the gene are the cause of 17beta-hydroxysteroid dehydrogenase type 10 (HSD10) deficiency. Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203539 | HSD17B10 (Myc-DDK-tagged)-Human hydroxysteroid (17-beta) dehydrogenase 10 (HSD17B10), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 2,400.00 |
|
RC203539L3 | Lenti ORF clone of Human hydroxysteroid (17-beta) dehydrogenase 10 (HSD17B10), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203539L4 | Lenti ORF clone of Human hydroxysteroid (17-beta) dehydrogenase 10 (HSD17B10), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG203539 | HSD17B10 (tGFP-tagged) - Human hydroxysteroid (17-beta) dehydrogenase 10 (HSD17B10), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,000.00 |