PYCR3 (NM_023078) Human Untagged Clone
CAT#: SC319194
PYCRL (untagged)-Human pyrroline-5-carboxylate reductase-like (PYCRL)
CNY 2,400.00
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PYCRL |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_023078.1
CGGCCTGTGGATGGGCGGTGAGCGCAGCGGCGTCCGAGGCAACAAGATGGCAGCTGCGGA
GCCGTCTCCGCGGCGCGTGGGCTTCGTGGGCGCGGGCCGCATGGCGGGGGCCATCGCGCA GGGCCTCATCAGAGCAGGAAAAGTGGAAGCTCAGCACATACTGGCCAGTGCACCAACAGA CAGGAACCTATGTCACTTTCAAGCTCTGGGTTGCCGGACCACGCACTCCAACCAGGAGGT GCTGCAGAGCTGCCTGCTCGTCATCTTTGCCACCAAGCCTCATGTGCTGCCAGCTGTCCT GGCAGAGGTGGCTCCTGTGGTCACCACTGAACACATCTTGGTGTCCGTGGCTGCTGGGGT GTCTCTGAGCACCCTGGAGGAGCTGCTGCCCCCAAACACACGGGTGCTGCGGGTCTTGCC CAACCTGCCCTGTGTGGTCCAGGAAGGGGCCATAGTGATGGCGCGGGGCCGCCACGTGGG GAGCAGCGAGACCAACCTCCTGCAGCATCTGCTGGAGGCCTGTGGGCGGTGTGAGGAGGT GCCTGAAGCCTACGTCGACATCCACACTGGCCTCAGTGGCAGTGGCGTGGCCTTCGTGTG TGCATTCTCCGAGGCCCTGGCTGAAGGAGCCGTCAAGATGGGCATGCCCAGCAGCCTGGC CCACCGCATCGCTGCCCAGACCCTGCTGGGGACGGCCAAGATGCTGCTGCACGAGGGCCA ACACCCAGCCCAGCTGCGCTCAGACGTGTGCACCCCGGGTGGCACCACCATCTATGGACT CCACGCCCTGGAGCAGGGCGGGCTGCGAGCAGCCACCATGAGCGCCGTGGAGGCTGCCAC CTGCCGGGCCAAGGAGCTCAGCAGAAAGTAGGCTGGGCTCTGGCCATCCTTTCCTGCCTC TGTGCCCCTGCCTCTCCCTGTGTCCCTTCCCCTGAGGACTGCGGCTCCCTCCCTCCTGCA TGAGGGTCTCCTACTGCTCCTTCTCCCCTTGCACAGGGAAATGCAGGGGGCAGGACTTGG GAGGTTCCAGCAGGCGGGGGAGCCCCGACCAGTGGGGACACTCCTCCCTCCCCAGTGAGC AGAAGGCACCGTGGTGGTGGCTCTGCCCCTTGCTGCAGTGAGCCCACCTTGCTGCAACAT TGGTTCTGAGGGGCCCAAGAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_023078 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_023078.1, NP_075566.1 |
RefSeq Size | 2678 bp |
RefSeq ORF | 825 bp |
Locus ID | 65263 |
UniProt ID | Q53H96 |
Domains | P5CR |
Protein Pathways | Arginine and proline metabolism, Metabolic pathways |
Gene Summary | This gene encodes a protein that belongs to the pyrroline-5-carboxylate reductase family of enzymes. Members of this family catalyze the final step in proline biosynthesis, converting pyrroline-5-carboxylate to proline. Glutamate and ornithine are precursors in the synthesis of proline. The protein encoded by this gene is a cytoplasmic enzyme involved in the biosynthesis of proline from ornithine. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203382 | PYCRL (Myc-DDK-tagged)-Human pyrroline-5-carboxylate reductase-like (PYCRL) |
CNY 2,400.00 |
|
RC203382L3 | Lenti ORF clone of Human pyrroline-5-carboxylate reductase-like (PYCRL), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203382L4 | Lenti ORF clone of Human pyrroline-5-carboxylate reductase-like (PYCRL), mGFP tagged |
CNY 5,890.00 |
|
RG203382 | PYCRL (tGFP-tagged) - Human pyrroline-5-carboxylate reductase-like (PYCRL) |
CNY 4,000.00 |
|
SC327776 | PYCRL (untagged)-Human pyrroline-5-carboxylate reductase-like (PYCRL) |
CNY 6,270.00 |