EIF3K (NM_013234) Human Untagged Clone

CAT#: SC319181

EIF3K (untagged)-Human eukaryotic translation initiation factor 3, subunit K (EIF3K)



  "NM_013234" in other vectors (4)

CNY 2,400.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


EIF3K rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARG134; EIF3-p28; EIF3S12; HSPC029; M9; MSTP001; PLAC-24; PLAC24; PRO1474; PTD001
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_013234.2 ACCACCTCTTCCTGTTCCCGTCCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGC
CCTGGTTGTGGAAGGCGACAGAAGTCATGGCGATGTTTGAGCAGATGAGAGCCAACGTGG
GCAAGTTGCTCAAGGGTATCGACAGGTACAATCCTGAGAACCTGGCCACCCTGGAGCGCT
ATGTAGAGACGCAGGCCAAGGAAAATGCCTATGATCTGGAAGCCAACCTGGCTGTCCTGA
AGCTGTACCAGTTCAACCCAGCCTTCTTTCAGACCACGGTCACCGCCCAGATCCTGCTGA
AGGCCCTCACCAACTTGCCGCACACAGACTTCACCCTGTGCAAGTGCATGATCGACCAGG
CACATCAAGAAGAACGGCCAATCCGACAGATTTTGTACCTCGGGGACCTGCTGGAGACCT
GCCATTTCCAGGCCTTCTGGCAAGCCCTGGATGAAAACATGGACCTCTTGGAAGGTATAA
CTGGCTTTGAAGACTCTGTCCGAAAGTTTATCTGCCATGTTGTGGGTATCACTTACCAGC
ACATTGACCGCTGGCTGCTGGCCGAGATGCTCGGGGATCTGTCGGACAGCCAGCTAAAGG
TGTGGATGAGCAAATACGGCTGGAGTGCCGACGAGTCGGGGCAGATCTTCATCTGTAGCC
AAGAAGAGAGCATTAAACCCAAGAACATTGTGGAGAAGATTGACTTTGACAGTGTGTCCA
GCATCATGGCCTCCTCCCAGTAACTTCAGGTGTTTAATAAAGATGTGTTGACTCAAAAAA
AAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_013234
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013234.2, NP_037366.1
RefSeq Size 910 bp
RefSeq ORF 657 bp
Locus ID 27335
UniProt ID Q9UBQ5
Gene Summary The 700-kD eukaryotic translation initiation factor-3 (eIF3) is the largest eIF and contains at least 12 subunits, including EIF2S12. eIF3 plays an essential role in translation by binding directly to the 40S ribosomal subunit and promoting formation of the 40S preinitiation complex (Mayeur et al., 2003 [PubMed 14519125]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...