DUSP12 (NM_007240) Human Untagged Clone
CAT#: SC319165
DUSP12 (untagged)-Human dual specificity phosphatase 12 (DUSP12)
CNY 3,656.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DUSP1; YVH1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_007240.1
GGCACGAGGCCGCCTTGTCTCTGGGCGCGGCCATGTTGGAGGCTCCGGGCCCGAGTGATG
GCTGCGAGCTCAGCAACCCCAGCGCCAGCAGAGTCAGCTGTGCCGGGCAGATGCTGGAAG TGCAGCCAGGATTGTATTTCGGTGGGGCCGCGGCCGTCGCGGAGCCAGATCACCTGAGGG AAGCGGGCATCACGGCCGTGCTAACAGTGGACTCGGAGGAGCCCAGCTTCAAGGCGGGGC CTGGGGTCGAGGATCTATGGCGCCTCTTCGTGCCAGCGCTGGACAAACCCGAGACGGACC TACTCAGCCATCTGGACCGGTGCGTGGCCTTCATCGGTCAGGCCCGCGCTGAGGGCCGTG CGGTGTTGGTGCACTGTCATGCAGGAGTCAGTCGAAGTGTGGCCATAATAACTGCTTTTC TCATGAAGACTGACCAACTTCCCTTTGAAAAAGCCTATGAAAAGCTCCAGATTCTCAAAC CAGAGGCTAAGATGAATGAGGGGTTTGAGTGGCAACTGAAATTATACCAGGCAATGGGAT ATGAAGTGGATACCTCTAGTGCAATTTATAAGCAATATCGTTTACAAAAGGTTACAGAGA AGTATCCAGAATTGCAGAATTTACCTCAAGAACTCTTTGCTGTTGACCCAACTACCGTTT CACAAGGATTGAAAGATGAGGTTCTCTACAAGTGTAGAAAGTGCAGGCGATCATTATTTC GAAGTTCTAGTATTCTGGATCACCGTGAAGGAAGTGGACCTATAGCCTTTGCCCACAAGA GAATGACACCATCTTCCATGCTTACCACAGGGAGGCAAGCTCAATGTACATCTTATTTCA TTGAACCTGTACAGTGGATGGAATCTGCTTTGTTGGGAGTGATGGATGGACAGCTTCTTT GCCCAAAATGCAGTGCCAAGTTGGGTTCCTTCAACTGGTATGGTGAACAGTGCTCTTGTG GTAGGTGGATAACACCTGCTTTTCAAATACATAAGAATAGAGTGGATGAAATGAAAATAT TGCCTGTTTTGGGATCACAAACAGGAAAAATATGAACATGATATTTTATAGCTTGGGAAG AAACTTGCAGATGATATGTGCTGCCTTTGCTTCTTATCATTCATGGCAGATTGTTTGTGC TTTCAACATTTCATTTGAAATGGGAGAAGATAAAATCACTTGATGTAACCTGGAAACTAT GCTTTACATGGCAATCAAAGCCTTTTGATCATGTACATTTTATTTGATATTAAAATCTTT TATAACCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_007240 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007240.1, NP_009171.1 |
RefSeq Size | 1271 bp |
RefSeq ORF | 1023 bp |
Locus ID | 11266 |
UniProt ID | Q9UNI6 |
Domains | DSPc |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is the human ortholog of the Saccharomyces cerevisiae YVH1 protein tyrosine phosphatase. It is localized predominantly in the nucleus, and is novel in that it contains, and is regulated by a zinc finger domain. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202411 | DUSP12 (Myc-DDK-tagged)-Human dual specificity phosphatase 12 (DUSP12) |
CNY 3,656.00 |
|
RC202411L1 | Lenti ORF clone of Human dual specificity phosphatase 12 (DUSP12), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC202411L2 | Lenti ORF clone of Human dual specificity phosphatase 12 (DUSP12), mGFP tagged |
CNY 5,890.00 |
|
RC202411L3 | Lenti ORF clone of Human dual specificity phosphatase 12 (DUSP12), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202411L4 | Lenti ORF clone of Human dual specificity phosphatase 12 (DUSP12), mGFP tagged |
CNY 5,890.00 |
|
RG202411 | DUSP12 (tGFP-tagged) - Human dual specificity phosphatase 12 (DUSP12) |
CNY 5,256.00 |