United States
Germany
Japan
United Kingdom
China
NQO2 (NM_000904) Human Untagged Clone
CAT＃: SC319150
NQO2 (untagged)-Human NAD(P)H dehydrogenase, quinone 2 (NQO2)
CNY 2,400.00
CNY 2,950.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DHQV; DIA6; NMOR2; QR2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_000904.1
GATTGCTGGACTCGCTGAAGAGAGACTACGCAGGAAAGCCCCAGCCACCCATCAAATCAG
AGAGAAGGAATCCACCTTCTTACGCTATGGCAGGTAAGAAAGTACTCATTGTCTATGCAC ACCAGGAACCCAAGTCTTTCAACGGATCCTTGAAGAATGTGGCTGTAGATGAACTGAGCA GGCAGGGCTGCACCGTCACAGTGTCTGATTTGTATGCCATGAACTTTGAGCCGAGGGCCA CAGACAAAGATATCACTGGTACTCTTTCTAATCCTGAGGTTTTCAATTATGGAGTGGAAA CCCACGAAGCCTACAAGCAAAGGTCTCTGGCTAGCGACATCACTGATGAGCAGAAAAAGG TTCGGGAGGCTGACCTAGTGATATTTCAGTTCCCGCTGTACTGGTTCAGCGTGCCGGCCA TCCTGAAGGGCTGGATGGATAGGGTGCTGTGCCAGGGCTTTGCCTTTGACATCCCAGGAT TCTACGATTCCGGTTTGCTCCAGGGTAAACTAGCGCTCCTTTCCGTAACCACGGGAGGCA CGGCCGAGATGTACACGAAGACAGGAGTCAATGGAGATTCTCGATACTTCCTGTGGCCAC TCCAGCATGGCACATTACACTTCTGTGGATTTAAAGTCCTTGCCCCTCAGATCAGCTTTG CTCCTGAAATTGCATCCGAAGAAGAAAGAAAGGGGATGGTGGCTGCGTGGTCCCAGAGGC TGCAGACCATCTGGAAGGAAGAGCCCATCCCCTGCACAGCCCACTGGCACTTCGGGCAAT AACTCTGTGGCACGTGGGCATCACGTAAGCAGCACACTAGGAGGCCCAGGCGCAGGCAAA GAGAAGATGGTGCTGTCATGAAATAAAATTACAACATAGCTAAAAAAAAAAAAAAAAAAA A |
| Restriction Sites | Please inquire |
| ACCN | NM_000904 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000904.1, NP_000895.1 |
| RefSeq Size | 976 bp |
| RefSeq ORF | 696 bp |
| Locus ID | 4835 |
| UniProt ID | P16083 |
| Domains | Flavodoxin_2 |
| Gene Summary | This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014] Transcript Variant: This variant (3) lacks three exons in the 5' UTR compared to variant 1. Variants 1, 3, and 4 encode the same protein (isoform 1). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Reduction and scavenging of chemically reactive drug metabolites by NAD(P)H:quinone oxidoreductase 1 and NRH:quinone oxidoreductase 2 and variability in hepatic concentrations
,den Braver-Sewradj, SP;den Braver, MW;Toorneman, RM;van Leeuwen, S;Zhang, Y;Dekker, SJ;Vermeulen, NPE;Commandeur, JNM;Vos, JC;,
Chem. Res. Toxicol.
,PubMed ID 29281794
[NQO2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202889 | NQO2 (Myc-DDK-tagged)-Human NAD(P)H dehydrogenase, quinone 2 (NQO2) |
CNY 2,400.00 |
|
| RC202889L1 | Lenti ORF clone of Human NAD(P)H dehydrogenase, quinone 2 (NQO2), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC202889L2 | Lenti ORF clone of Human NAD(P)H dehydrogenase, quinone 2 (NQO2), mGFP tagged |
CNY 5,890.00 |
|
| RC202889L3 | Lenti ORF clone of Human NAD(P)H dehydrogenase, quinone 2 (NQO2), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202889L4 | Lenti ORF clone of Human NAD(P)H dehydrogenase, quinone 2 (NQO2), mGFP tagged |
CNY 4,800.00 |
|
| RG202889 | NQO2 (tGFP-tagged) - Human NAD(P)H dehydrogenase, quinone 2 (NQO2) |
CNY 4,000.00 |
