United States
Germany
Japan
United Kingdom
China
MYL9 (NM_181526) Human Untagged Clone
CAT＃: SC319114
MYL9 (untagged)-Human myosin, light chain 9, regulatory (MYL9), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | LC20; MLC-2C; MLC2; MMIHS4; MRLC1; MYRL2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_181526.1
CGCCTTCTCCGCACCAGGGAAGCCCCACCCACCAGAAGCCAAGATGTCCAGCAAGCGGGC
CAAAGCCAAGACCACCAAGAAGCGGCCACAGCGGGCCACATCCAATGTCTTCGCAATGTT TGACCAGTCCCAGATCCAGGAGTTTAAGGAGGCTTTCAACATGATTGACCAGAACCGTGA TGGCTTCATTGACAAGGAGGACCTGCACGACATGCTGGCCTCGCTGGGTTTCATCCATGA GGACCACCTCCGGGAGCTGCTCACCACCATGGGTGACCGCTTCACAGATGAGGAAGTGGA CGAGATGTACCGGGAGGCACCCATTGATAAGAAAGGCAACTTCAACTACGTGGAGTTCAC CCGCATCCTCAAACATGGCGCCAAGGATAAAGACGACTAGGCCACCCCAGCCCCCTGACA CCCCAGCCCCCGCCAGTCACCCCTCCCCGCACACACCCGTCCATACCAGCTCCCTGCCCA TGACCCTCGCTCAGGGATCCCCCTTTGAGGGGTTAGGGTCCCAGTTCCCAGTGGAAGAAA CAGGCCAGGAGAAGTGCGTGCCGAGCTGAGGCAGATGTTCCCACAGTGACCCCAGAGCCC TGGGCTATAGTCTCTGACCCCTCCAAGGAAAGACCACCTTCTGGGGACATGGGCTGGAGG GCAGGACCTAGAGGCACCAAGGGAAGGCCCCATTCCGGGGCTGTTCCCCGAGGAGGAAGG GAAGGGGCTCTGTGTGCCCCCCAGGAGGAAGAGGCCCTGAGTCCTGGGATCAGACACCCC TTCACGTGTATCCCCACACAAATGCAAGCTCACCAAGGTCCCCTCTCAGTCCCCTTCCCT ACACCCTGACCGGCCACTGCCGCACACCCACCCAGAGCACGCCACCCGCCATGGGAGTGT GCTCAGGAGTCGCGGGCAGCGTGGACATCTGTCCCAGAGGGGGCAGAATCTCCAATAGAG GACTGAGCACTGCTAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_181526 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181526.1, NP_852667.1 |
| RefSeq Size | 1044 bp |
| RefSeq ORF | 357 bp |
| Locus ID | 10398 |
| UniProt ID | P24844 |
| Protein Pathways | Focal adhesion, Leukocyte transendothelial migration, Regulation of actin cytoskeleton, Tight junction, Vascular smooth muscle contraction |
| Gene Summary | Myosin, a structural component of muscle, consists of two heavy chains and four light chains. The protein encoded by this gene is a myosin light chain that may regulate muscle contraction by modulating the ATPase activity of myosin heads. The encoded protein binds calcium and is activated by myosin light chain kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1, resulting in a shorter isoform (b) compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201080 | MYL9 (Myc-DDK-tagged)-Human myosin, light chain 9, regulatory (MYL9), transcript variant 2 |
CNY 1,200.00 |
|
| RC201080L1 | Lenti ORF clone of Human myosin, light chain 9, regulatory (MYL9), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC201080L2 | Lenti ORF clone of Human myosin, light chain 9, regulatory (MYL9), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC201080L3 | Lenti ORF clone of Human myosin, light chain 9, regulatory (MYL9), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC201080L4 | Lenti ORF clone of Human myosin, light chain 9, regulatory (MYL9), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG201080 | MYL9 (tGFP-tagged) - Human myosin, light chain 9, regulatory (MYL9), transcript variant 2 |
CNY 2,800.00 |
