NDUF3 (NDUFAF3) (NM_199074) Human Untagged Clone
CAT#: SC319101
NDUFAF3 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 (NDUFAF3), nuclear gene encoding mitochondrial protein, transcript variant 4
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 2P1; C3orf60; E3-3; MC1DN18 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_199074.1
GGCACGAGGCCCAACCCGGGGACTAACGGCGCCGGTGACGACTTCGCCGCGCGTTGGTCA
GCCATGGCCACCGCTCTCGCGCTACGTAGCTTGTACCGAGCGCGACCCTCGCTGCGCTGT CCGCCCGTTGAGCTTCCCTGGGCCCCGCGGCGAGGGCATCGGCTCTCGCCGGCGGATGAC GAGCTGTATCAGCGGACGCGCATCTCTCTGCTGCAACGCGAGGCCGCTCAGGCAATGTAC ATCGACAGCTACAACAGCCGCGGCTTCATGATAAACGGAAACCGCGTGCTCGGCCCCTGC GCTCTGCTCCCGCACTCGGTGGTGCAGTGGAACGTGGGATCCCACCAGGACATCACCGAA GACAGCTTTTCCCTCTTCTGGTTGCTGGAGCCCCGGATAGAGATCGTGGTGGTGGGGACT GGAGACCGGACCGAGAGGCTGCAGTCCCAGGTGCTTCAAGCCATGAGGCAGCGGGGCATT GCTGTGGAAGTGCAGGACACGCCCAATGCCTGTGCCACCTTCAACTTCCTGTGTCATGAA GGCCGAGTAACTGGAGCTGCTCTCATCCCTCCACCAGGAGGGACTTCACTTACATCTTTG GGCCAAGCTGCTCAATGAACCGCCAGGAACTGACCTGCTGACTGCACTCTGCCAGGCTTC CCAATGCTTTCACTCTTATCTACCCTTTGGCACTTATCTTGCTTATCAACATAATAATTT ATACACTTCTCCCAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_199074 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_199074.1, NP_951056.1 |
RefSeq Size | 902 bp |
RefSeq ORF | 384 bp |
Locus ID | 25915 |
Gene Summary | This gene encodes a mitochondrial complex I assembly protein that interacts with complex I subunits. Mutations in this gene cause mitochondrial complex I deficiency, a fatal neonatal disorder of the oxidative phosphorylation system. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2009] Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Variants 2, 3 and 4 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202480 | NDUFAF3 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 (NDUFAF3), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 2,400.00 |
|
RC202480L3 | Lenti-ORF clone of NDUFAF3 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 (NDUFAF3), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 5,890.00 |
|
RC202480L4 | Lenti-ORF clone of NDUFAF3 (mGFP-tagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 (NDUFAF3), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 5,890.00 |
|
RG202480 | NDUFAF3 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 (NDUFAF3), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 4,370.00 |