STARD5 (NM_181900) Human Untagged Clone
CAT#: SC319080
STARD5 (untagged)-Human StAR-related lipid transfer (START) domain containing 5 (STARD5)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_181900.2
CGCAGCTAAGCGCAGCTCCCGACGCAATGGACCCGGCGCTGGCAGCCCAGATGAGCGAGG
CTGTGGCCGAGAAGATGCTCCAGTACCGGCGGGACACAGCAGGCTGGAAGATTTGCCGGG AAGGCAATGGAGTTTCAGTTTCCTGGAGGCCATCTGTGGAGTTTCCAGGGAACCTGTACC GAGGAGAAGGCATTGTATATGGGACACTAGAGGAGGTGTGGGACTGTGTGAAGCCAGCTG TTGGAGGCCTACGAGTGAAGTGGGATGAGAATGTGACCGGTTTTGAAATTATCCAAAGCA TCACTGACACCCTGTGTGTAAGCAGAACCTCCACTCCCTCCGCTGCCATGAAGCTCATTT CTCCCAGAGATTTTGTGGACTTGGTGCTAGTCAAGAGATATGAGGATGGGACCATCAGTT CCAACGCCACCCATGTGGAGCATCCGTTATGTCCCCCGAAGCCAGGTTTTGTGAGAGGAT TTAACCATCCTTGTGGTTGCTTCTGTGAACCTCTTCCAGGGGAACCCACCAAGACCAACC TGGTCACATTCTTCCATACCGACCTCAGCGGTTACCTCCCACAGAACGTGGTGGACTCCT TCTTCCCCCGCAGCATGACCCGGTTTTATGCCAACCTTCAGAAAGCAGTGAAGCAATTCC ATGAGTAATGCTATCGTTACTTCTTGGCAAAGAACTCCCGTGACTCATCGAGGAGCTCCA GCTGTTGGGACACCAAGGAGCCTGGGAGCACGCAGAGGCCTGTGTTCACTCTTTGGAACA AGCTGATGGACTGCGCATCTCTGAGAATGCCAACCAGAGGCGGCAGCCCACCCTTCCTGC CTCCTGCCCCACTCAGGGTTGGCGTGTGATGAGCCATTCATGTGTTCCAAACTCCATCTG CCTGTTACCCAAACGCCTCTCCTGGCAGGGTAGACCCAGGCCTCTAACCATCTGACAGAG ACTCGGCCTGGACACCATGCGATGCACTCTGGCACCAAGGCTTTATGTGCCCATCACTCT CAGAGACCACGTTTCTCTGACTGTCATAGAGAATCATCATCGCCACTGAAAACCAGGCCC TGTTGCCTTTTAAGCATGTACCGCTCCCTCAGTCCTGTGCTGCAGCCCCCCAAATATATT TTTCTGATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAC |
Restriction Sites | Please inquire |
ACCN | NM_181900 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_181900.2, NP_871629.1 |
RefSeq Size | 1344 bp |
RefSeq ORF | 642 bp |
Locus ID | 80765 |
UniProt ID | Q9NSY2 |
Gene Summary | Proteins containing a steroidogenic acute regulatory-related lipid transfer (START) domain are often involved in the trafficking of lipids and cholesterol between diverse intracellular membranes. This gene is a member of the StarD subfamily that encodes START-related lipid transfer proteins. The protein encoded by this gene is a cholesterol transporter and is also able to bind and transport other sterol-derived molecules related to the cholesterol/bile acid biosynthetic pathways such as 25-hydroxycholesterol. Its expression is upregulated during endoplasmic reticulum (ER) stress. The protein is thought to act as a cytosolic sterol transporter that moves cholesterol between intracellular membranes such as from the cytoplasm to the ER and from the ER to the Golgi apparatus. Alternative splicing of this gene produces multiple transcript variants. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (1) represents the longer transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202407 | STARD5 (Myc-DDK-tagged)-Human StAR-related lipid transfer (START) domain containing 5 (STARD5) |
CNY 2,400.00 |
|
RC202407L1 | Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 5 (STARD5), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC202407L2 | Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 5 (STARD5), mGFP tagged |
CNY 5,890.00 |
|
RC202407L3 | Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 5 (STARD5), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202407L4 | Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 5 (STARD5), mGFP tagged |
CNY 5,890.00 |
|
RG202407 | STARD5 (tGFP-tagged) - Human StAR-related lipid transfer (START) domain containing 5 (STARD5) |
CNY 4,000.00 |