IFNAR2 (NM_207584) Human Untagged Clone
CAT#: SC319068
IFNAR2 (untagged)-Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 3
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IFN-alpha-REC; IFN-R; IFNABR; IFNARB; IMD45 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_207584.1
GCCCCCGCGCCGGCGGCGGCGCGGCGCCCGCGCTTCCGTAGCGCTCCTCGTAGGCCGGGG
CTCGGCGCGCGCACCCGCACTAAAGACGCTTCTTCCCGGAGGGTAGGAATCCCGCCGGCG AGCCGAACAGTTCCCCGAGCGCAGCCCGCGGACCACCACCCGGCCGCACGGGCCGCTTTT GTCCCCCGCCCGCCGCTTCTGTCCGAGAGGCCGCCCGCGAGGCGCATCCTGACCGCGAGC GTCGGGTCCCAGAGCCGGGCGCGGCTGGGGCCCGAGGCTAGCATCTCTCGGGAGCCGCAA GGCGAGAGCTGCAAAGATGTAAAAGTCAAGAGAAGACTCTAAAAATAGCAAAGATGCTTT TGAGCCAGAATGCCTTCATCGTCAGATCACTTAATTTGGTTCTCATGGTGTATATCAGCC TCGTGTTTGGTATTTCATATGATTCGCCTGATTACACAGATGAATCTTGCACTTTCAAGA TATCATTGCGAAATTTCCGGTCCATCTTATCATGGGAATTAAAAAACCACTCCATTGTAC CAACTCACTATACATTGCTGTATACAATCATGAGTAAACCAGAAGATTTGAAGGTGGTTA AGAACTGTGCAAATACCACAAGATCATTTTGTGACCTCACAGATGAGTGGAGAAGCACAC ACGAGGCCTATGTCACCGTCCTAGAAGGATTCAGCGGGAACACAACGTTGTTCAGTTGCT CACACAATTTCTGGCTGGCCATAGACATGTCTTTTGAACCACCAGAGTTTGAGATTGTTG GTTTTACCAACCACATTAATGTGATGGTGAAATTTCCATCTATTGTTGAGGAAGAATTAC AGTTTGATTTATCTCTCGTCATTGAAGAACAGTCAGAGGGAATTGTTAAGAAGCATAAAC CCGAAATAAAAGGAAACATGAGTGGAAATTTCACCTATATCATTGACAAGTTAATTCCAA ACACGAACTACTGTGTATCTGTTTATTTAGAGCACAGTGATGAGCAAGCAGTAATAAAGT CTCCCTTAAAATGCACCCTCCTTCCACCTGGCCAGGAATCAGAATCAGCAGAATCTGCCA AAATAGGAGGAATAATTACTGTGTTTTTGATAGCATTGGTCTTGACAAGCACCATAGTGA CACTGAAATGGATTGGTTATATATGCTTAAGAAATAGCCTCCCCAAAGTCTTGAGGCAAG GTCTCACTAAGGGCTGGAATGCAGTGGCTATTCACAGGTGCAGTCATAATGCACTACAGT CTGAAACTCCTGAGCTCAAACAGTCGTCCTGCCTAAGCTTCCCCAGTAGCTGGGATTACA AGCGTGCATCCCTGTGCCCCAGTGATTAAGTTTTATTATGTAGAAAATAAAGAGCAAACA GTTACAGCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_207584 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_207584.1, NP_997467.1 |
RefSeq Size | 1382 bp |
RefSeq ORF | 996 bp |
Locus ID | 3455 |
UniProt ID | P48551 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Toll-like receptor signaling pathway |
Gene Summary | The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The protein belongs to the type II cytokine receptor family. Mutations in this gene are associated with Immunodeficiency 45. [provided by RefSeq, Jul 2020] Transcript Variant: This variant (3) differs in the 3' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a. Variants 2 and 3 both encode isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201212 | IFNAR2 (Myc-DDK-tagged)-Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 3 |
CNY 2,400.00 |
|
RC201212L1 | Lenti ORF clone of Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC201212L2 | Lenti ORF clone of Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RC201212L3 | Lenti ORF clone of Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC201212L4 | Lenti ORF clone of Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 3, mGFP tagged |
CNY 4,800.00 |
|
RG201212 | IFNAR2 (tGFP-tagged) - Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 3 |
CNY 4,000.00 |