FOLR2 (NM_001113534) Human Untagged Clone

CAT#: SC318808

FOLR2 (untagged)-Human folate receptor 2 (fetal) (FOLR2), transcript variant 2



  "NM_001113534" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
FOLR2 mouse monoclonal antibody, clone OTI4G6 (formerly 4G6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BETA-HFR; FBP; FBP/PL-1; FOLR1; FR-BETA; FR-P3; FRbeta
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC318808 representing NM_001113534.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTCTGGAAATGGATGCCACTTCTGCTGCTTCTGGTCTGTGTAGCCACCATGTGCAGTGCCCAGGAC
AGGACTGATCTCCTCAATGTCTGTATGGATGCCAAGCACCACAAGACAAAGCCAGGTCCTGAGGACAAG
CTGCATGACCAATGCAGTCCCTGGAAGAAGAATGCCTGCTGCACAGCCAGCACCAGCCAGGAGCTGCAC
AAGGACACCTCCCGCCTGTACAACTTTAACTGGGACCACTGCGGCAAGATGGAGCCCGCCTGCAAGCGC
CACTTCATCCAGGACACCTGTCTCTATGAGTGCTCACCCAACCTGGGGCCCTGGATCCAGCAGGTGAAT
CAGAGCTGGCGCAAAGAACGCTTCCTGGATGTGCCCTTATGCAAAGAGGACTGTCAGCGCTGGTGGGAG
GATTGTCACACCTCCCACACGTGCAAGAGCAACTGGCACAGAGGATGGGACTGGACCTCAGGAGTTAAC
AAGTGCCCAGCTGGGGCTCTCTGCCGCACCTTTGAGTCCTACTTCCCCACTCCAGCTGCCCTTTGTGAA
GGCCTCTGGAGTCACTCATACAAGGTCAGCAACTACAGCCGAGGGAGCGGCCGCTGCATCCAGATGTGG
TTTGATTCAGCCCAGGGCAACCCCAACGAGGAAGTGGCGAGGTTCTATGCTGCAGCCATGCATGTGAAT
GCTGGTGAGATGCTTCATGGGACTGGGGGTCTCCTGCTCAGTCTGGCCCTGATGCTGCAACTCTGGCTC
CTTGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001113534
Insert Size 768 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001113534.1
RefSeq Size 1139 bp
RefSeq ORF 768 bp
Locus ID 2350
UniProt ID P14207
Protein Families Druggable Genome, Secreted Protein
MW 29.3 kDa
Gene Summary The protein encoded by this gene is a member of the folate receptor (FOLR) family, and these genes exist in a cluster on chromosome 11. Members of this gene family have a high affinity for folic acid and for several reduced folic acid derivatives, and they mediate delivery of 5-methyltetrahydrofolate to the interior of cells. This protein has a 68% and 79% sequence homology with the FOLR1 and FOLR3 proteins, respectively. Although this protein was originally thought to be specific to placenta, it can also exist in other tissues, and it may play a role in the transport of methotrexate in synovial macrophages in rheumatoid arthritis patients. Multiple transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. All variants (1-4) encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...