RUNX1 (NM_001122607) Human Untagged Clone
CAT#: SC318805
RUNX1 (untagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 3
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AML1; AML1-EVI-1; AMLCR1; CBF2alpha; CBFA2; EVI-1; PEBP2aB; PEBP2alpha |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001122607 edited
ATGCGTATCCCCGTAGATGCCAGCACGAGCCGCCGCTTCACGCCGCCTTCCACCGCGCTG AGCCCAGGCAAGATGAGCGAGGCGTTGCCGCTGGGCGCCCCGGACGCCGGCGCTGCCCTG GCCGGCAAGCTGAGGAGCGGCGACCGCAGCATGGTGGAGGTGCTGGCCGACCACCCGGGC GAGCTGGTGCGCACCGACAGCCCCAACTTCCTCTGCTCCGTGCTGCCTACGCACTGGCGC TGCAACAAGACCCTGCCCATCGCTTTCAAGGTGGTGGCCCTAGGGGATGTTCCAGATGGC ACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATGCT ACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAAGT GGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCC ACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGG CAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAA CTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCACACCACCCAGCCCCCACGCCC AACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATG CAGGAGGAAGACACAGCACCCTGGAGATGTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001122607 |
Insert Size | 800 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001122607.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001122607.1, NP_001116079.1 |
RefSeq Size | 2722 bp |
RefSeq ORF | 753 bp |
Locus ID | 861 |
UniProt ID | Q01196 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Protein Pathways | Acute myeloid leukemia, Chronic myeloid leukemia, Pathways in cancer |
Gene Summary | Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR and coding region as well as the 3' UTR and coding region compared to variant 1. The resulting isoform (AML1a) is shorter and has distinct N- and C-termini compared to isoform AML1c. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225321 | RUNX1 (Myc-DDK-tagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 3 |
CNY 3,600.00 |
|
RC225321L1 | Lenti-ORF clone of RUNX1 (Myc-DDK-tagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 3 |
CNY 6,000.00 |
|
RC225321L2 | Lenti-ORF clone of RUNX1 (mGFP-tagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 3 |
CNY 5,890.00 |
|
RC225321L3 | Lenti-ORF clone of RUNX1 (Myc-DDK-tagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 3 |
CNY 5,890.00 |
|
RC225321L4 | Lenti-ORF clone of RUNX1 (mGFP-tagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 3 |
CNY 5,890.00 |
|
RG225321 | RUNX1 (tGFP-tagged) - Human runt-related transcription factor 1 (RUNX1), transcript variant 3 |
CNY 5,200.00 |