C1QC (NM_001114101) Human Untagged Clone
CAT#: SC318803
C1QC (untagged)-Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C1Q-C; C1QG |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC318803 representing NM_001114101.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACGTGGGGCCCAGCTCCCTGCCCCACCTTGGGCTGAAGCTGCTGCTGCTCCTGCTGCTGCTGCCC CTCAGGGGCCAAGCCAACACAGGCTGCTACGGGATCCCAGGGATGCCCGGCCTGCCCGGGGCACCAGGG AAGGATGGGTACGACGGACTGCCGGGGCCCAAGGGGGAGCCAGGAATCCCAGCCATTCCCGGGATCCGA GGACCCAAAGGGCAGAAGGGAGAACCCGGCTTACCCGGCCATCCTGGGAAAAATGGCCCCATGGGACCC CCTGGGATGCCAGGGGTGCCCGGCCCCATGGGCATCCCTGGAGAGCCAGGTGAGGAGGGCAGATACAAG CAGAAATTCCAGTCAGTGTTCACGGTCACTCGGCAGACCCACCAGCCCCCTGCACCCAACAGCCTGATC AGATTCAACGCGGTCCTCACCAACCCGCAGGGAGATTATGACACGAGCACTGGCAAGTTCACCTGCAAA GTCCCCGGCCTCTACTACTTTGTCTACCACGCGTCGCATACAGCCAACCTGTGCGTGCTGCTGTACCGC AGCGGCGTCAAAGTGGTCACCTTCTGTGGCCACACGTCCAAAACCAATCAGGTCAACTCGGGCGGTGTG CTGCTGAGGTTGCAGGTGGGCGAGGAGGTGTGGCTGGCTGTCAATGACTACTACGACATGGTGGGCATC CAGGGCTCTGACAGCGTCTTCTCCGGCTTCCTGCTCTTCCCCGACTAG AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT ATCCTGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001114101 |
Insert Size | 738 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001114101.1 |
RefSeq Size | 1205 bp |
RefSeq ORF | 738 bp |
Locus ID | 714 |
UniProt ID | P02747 |
Protein Families | Secreted Protein |
Protein Pathways | Complement and coagulation cascades, Prion diseases, Systemic lupus erythematosus |
MW | 25.8 kDa |
Gene Summary | This gene encodes the C-chain polypeptide of serum complement subcomponent C1q, which associates with C1r and C1s to yield the first component of the serum complement system. C1q is composed of 18 polypeptide chains which include 6 A-chains, 6 B-chains, and 6 C-chains. Each chain contains an N-terminal collagen-like region and a C-terminal C1q globular domain. C1q deficiency is associated with lupus erythematosus and glomerulonephritis. [provided by RefSeq, Dec 2016] Transcript Variant: This variant (1) encodes the longer isoform (1). Variants 1-3 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225312 | C1QC (Myc-DDK-tagged)-Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 1 |
CNY 2,400.00 |
|
RC225312L3 | Lenti ORF clone of Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225312L4 | Lenti ORF clone of Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG225312 | C1QC (tGFP-tagged) - Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 1 |
CNY 4,370.00 |