NACA (NM_001113202) Human Untagged Clone
CAT#: SC318798
NACA (untagged)-Human nascent polypeptide-associated complex alpha subunit (NACA), transcript variant 4
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HSD48; NAC-alpha; NACA1; skNAC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC318798 representing NM_001113202.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCCGGCGAAGCCACAGAAACCGTCCCTGCTACAGAGCAGGAGTTGCCGCAGCCCCAGGCTGAGACA GGGTCTGGAACAGAATCTGACAGTGATGAATCAGTACCAGAGCTTGAAGAACAGGATTCCACCCAGGCA ACCACACAACAAGCCCAGCTGGCGGCAGCAGCTGAAATTGATGAAGAACCAGTCAGTAAAGCAAAACAG AGTCGGAGTGAAAAGAAGGCACGGAAGGCTATGTCCAAACTGGGTCTTCGGCAGGTTACAGGAGTTACT AGAGTCACTATCCGGAAATCTAAGAATATCCTCTTTGTCATCACAAAACCAGATGTCTACAAGAGCCCT GCTTCAGATACTTACATAGTTTTTGGGGAAGCCAAGATCGAAGATTTATCCCAGCAAGCACAACTAGCA GCTGCTGAGAAATTCAAAGTTCAAGGTGAAGCTGTCTCAAACATTCAAGAAAACACACAGACTCCAACT GTACAAGAGGAGAGTGAAGAGGAAGAGGTCGATGAAACAGGTGTAGAAGTTAAGGACATTGAATTGGTC ATGTCACAAGCAAATGTGTCGAGAGCAAAGGCAGTCCGAGCCCTGAAGAACAACAGTAATGATATTGTA AATGCGATTATGGAATTAACAATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001113202 |
Insert Size | 648 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001113202.1 |
RefSeq Size | 1061 bp |
RefSeq ORF | 648 bp |
Locus ID | 4666 |
UniProt ID | Q13765 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 23.4 kDa |
Gene Summary | This gene encodes a protein that associates with basic transcription factor 3 (BTF3) to form the nascent polypeptide-associated complex (NAC). This complex binds to nascent proteins that lack a signal peptide motif as they emerge from the ribosome, blocking interaction with the signal recognition particle (SRP) and preventing mistranslocation to the endoplasmic reticulum. This protein is an IgE autoantigen in atopic dermatitis patients. Alternative splicing results in multiple transcript variants, but the full length nature of some of these variants, including those encoding very large proteins, has not been determined. There are multiple pseudogenes of this gene on different chromosomes. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (4) lacks three alternate exons in the central coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform b, which is shorter than isoform a. Variants 2, 3, 4, and 5, encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225257 | NACA (Myc-DDK-tagged)-Human nascent polypeptide-associated complex alpha subunit (NACA), transcript variant 4 |
CNY 2,400.00 |
|
RC225257L3 | Lenti ORF clone of Human nascent polypeptide-associated complex alpha subunit (NACA), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225257L4 | Lenti ORF clone of Human nascent polypeptide-associated complex alpha subunit (NACA), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
RG225257 | NACA (tGFP-tagged) - Human nascent polypeptide-associated complex alpha subunit (NACA), transcript variant 4 |
CNY 4,370.00 |