PARK7 (NM_001123377) Human Untagged Clone

CAT#: SC318792

PARK7 (untagged)-Human Parkinson disease (autosomal recessive, early onset) 7 (PARK7), transcript variant 2



  "NM_001123377" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit monoclonal anti-PARK7 antibody for SISCAPA, clone OTIR4F10
    • 100 ul

CNY 4,066.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DJ-1; DJ1; GATD2; HEL-S-67p
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC318792 representing NM_001123377.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTTCCAAAAGAGCTCTGGTCATCCTGGCTAAAGGAGCAGAGGAAATGGAGACGGTCATCCCTGTA
GATGTCATGAGGCGAGCTGGGATTAAGGTCACCGTTGCAGGCCTGGCTGGAAAAGACCCAGTACAGTGT
AGCCGTGATGTGGTCATTTGTCCTGATGCCAGCCTTGAAGATGCAAAAAAAGAGGGACCATATGATGTG
GTGGTTCTACCAGGAGGTAATCTGGGCGCACAGAATTTATCTGAGTCTGCTGCTGTGAAGGAGATACTG
AAGGAGCAGGAAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCAT
GAAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATGATGAATGGAGGTCAT
TACACCTACTCTGAGAATCGTGTGGAAAAAGACGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGC
TTCGAGTTTGCGCTTGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCA
CTTGTTCTTAAAGACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001123377
Insert Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001123377.1
RefSeq Size 921 bp
RefSeq ORF 570 bp
Locus ID 11315
UniProt ID Q99497
Protein Families Druggable Genome, Protease
Protein Pathways Parkinson's disease
MW 19.9 kDa
Gene Summary The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) represents the shorter transcript. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...