HCK (NM_002110) Human Untagged Clone

CAT#: SC317892

HCK (untagged)-Human hemopoietic cell kinase (HCK), transcript variant 1



  "NM_002110" in other vectors (8)

CNY 3,928.00

CNY 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-HCK Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms JTK9; p59Hck; p61Hck
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_002110 edited
ATGGGGGGGCGCTCAAGCTGCGAGGATCCGGGCTGCCCGCGAGACGAGGAGCGGGCGCCC
AGGATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGGGAGGCAGGCTCTGAGGAC
ATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTCCAG
AAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCCCTG
GCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTGGAG
ACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTGGCT
CCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGCTAC
TCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAGATC
CGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTGCAG
GAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTGCCC
TGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGGGAA
TCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCCACC
TACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTGGAG
GCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAACTT
CATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGAAGC
TTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATTGAC
TTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCACCGA
GACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGACTTT
GGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTCCCC
ATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGACGTC
TGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCAGGG
ATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCAGAG
AACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAGGAG
CGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAGAGC
CAGTACCAACAGCAGCCATGA
Restriction Sites Please inquire     
ACCN NM_002110
Insert Size 1600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002110.2, NP_002101.2
RefSeq Size 2105 bp
RefSeq ORF 1581 bp
Locus ID 3055
UniProt ID P08631
Domains pkinase, SH2, TyrKc, SH3, S_TKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Chemokine signaling pathway, Fc gamma R-mediated phagocytosis
Gene Summary The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (1) encodes two isoforms due to the use of alternative translation initiation codons, as demonstrated in PMIDs 1875927 and 7791757. The longer isoform (a, also known as p61HCK) is derived from an upstream non-AUG (CUG) start codon, while the shorter isoform (b, also known as p59HCK) is derived from a downstream AUG start codon. The longer isoform (a) is represented in this RefSeq. CCDS Note: This CCDS, which is supported by the mRNAs AK026432.1, BC108930.1 and others, represents a long human HCK isoform, known as p61HCK, as described in PMIDs 1875927 and 7791757. This isoform initiates translation from a non-AUG (CUG) start codon that is well-conserved and present in a strong Kozak signal context. Alternative translation initiation from a downstream AUG start codon produces an isoform that is 21 aa shorter at the N-terminus. The shorter isoform, which is known as p59HCK, is represented by CCDS 54455.1. These isoforms exhibit distinct subcellular distributions, as indicated in PMID:7791757.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...