SEPTIN7 (NM_001011553) Human Untagged Clone

CAT#: SC317714

41524 (untagged)-Human septin 7 (SEPT7), transcript variant 2



  "NM_001011553" in other vectors (4)

CNY 7,030.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SEPT7 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDC3; CDC10; NBLA02942; SEPT7; SEPT7A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317714 representing NM_001011553.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGGTCAGTGCGAGATCCGCTGCTGCTGAGGAGAGGAGCGTCAACAGCAGCACCATGGCTCAACAG
AAGAACCTTGAAGGCTATGTGGGATTTGCCAATCTCCCAAATCAAGTATACAGAAAATCGGTGAAGAGA
GGTTTTGAATTCACGCTTATGGTAGTGGGTGAATCTGGATTGGGAAAGTCGACATTAATCAACTCATTA
TTCCTCACAGATTTGTATTCTCCAGAGTATCCAGGTCCTTCTCATAGAATTAAAAAGACTGTACAGGTG
GAACAATCCAAAGTTTTAATCAAAGAAGGTGGTGTTCAGTTGCTGCTCACAATAGTTGATACCCCAGGA
TTTGGAGATGCAGTGGATAATAGTAATTGCTGGCAGCCTGTTATCGACTACATTGATAGTAAATTTGAG
GACTACCTAAATGCAGAATCACGAGTGAACAGACGTCAGATGCCTGATAACAGGGTGCAGTGTTGTTTA
TACTTCATTGCTCCTTCAGGACATGGACTTAAACCATTGGATATTGAGTTTATGAAGCGTTTGCATGAA
AAAGTGAATATCATCCCACTTATTGCCAAAGCAGACACACTCACACCAGAGGAATGCCAACAGTTTAAA
AAACAGATAATGAAAGAAATCCAAGAACATAAAATTAAAATATACGAATTTCCAGAAACAGATGATGAA
GAAGAAAATAAACTTGTTAAAAAGATAAAGGACCGTTTACCTCTTGCTGTGGTAGGTAGTAATACTATC
ATTGAAGTTAATGGCAAAAGGGTCAGAGGAAGGCAGTATCCTTGGGGTGTTGCTGAAGTTGAAAATGGT
GAACATTGTGATTTTACAATCCTAAGAAATATGTTGATAAGAACACACATGCAGGACTTGAAAGATGTT
ACTAATAATGTCCACTATGAGAACTACAGAAGCAGAAAACTTGCAGCTGTGACTTATAATGGAGTTGAT
AACAACAAGAATAAAGGGCAGCTGACTAAGAGCCCTCTGGCACAAATGGAAGAAGAAAGAAGGGAGCAT
GTAGCTAAAATGAAGAAGATGGAGATGGAGATGGAGCAGGTGTTTGAGATGAAGGTCAAAGAAAAAGTT
CAAAAACTGAAGGACTCTGAAGCTGAGCTCCAGCGGCGCCATGAGCAAATGAAAAAGAATTTGGAAGCA
CAGCACAAAGAATTGGAGGAAAAACGTCGTCAGTTCGAGGATGAGAAAGCAAACTGGGAAGCTCAACAA
CGTATTTTAGAACAACAGAACTCTTCAAGAACCTTGGAAAAGAACAAGAAGAAAGGGAAGATCTTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001011553
Insert Size 1311 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001011553.3
RefSeq Size 4377 bp
RefSeq ORF 1311 bp
Locus ID 989
MW 50.6 kDa
Gene Summary This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (2) lacks an in-frame segment in the 5' coding region, compared to variant 1, resulting in an isoform (2) that is 1 aa shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...