ACOT7 (NM_007274) Human Untagged Clone
CAT#: SC317591
ACOT7 (untagged)-Human acyl-CoA thioesterase 7 (ACOT7), transcript variant hBACHa
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ACH1; ACT; BACH; CTE-II; hBACH; LACH; LACH1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_007274, the custom clone sequence may differ by one or more nucleotides
ATGGCGCGGCCCGGGCTCATTCATTCCGCGCCGGGCCTGCCAGACACCTGCGCCCTTCTG CAGCCGCCCGCCGCATCCGCCGCCGCAGCCCCCAGCATGTCGGGCCCAGACGTCGAGACG CCGTCCGCCATCCAGATCTGCCGGATCATGCGGCCAGATGATGCCAACGTGGCCGGCAAT GTCCACGGGGGGACCATCCTGAAGATGATCGAGGAGGCAGGCGCCATCATCAGCACCCGG CATTGCAACAGCCAGAACGGGGAGCGCTGTGTGGCCGCCCTGGCTCGTGTCGAGCGCACC GACTTCCTGTCTCCCATGTGCATCGGTGAGGTGGCGCATGTCAGCGCGGAGATCACCTAC ACCTCCAAGCACTCTGTGGAGGTGCAGGTCAACGTGATGTCCGAAAACATCCTCACAGGT GCCAAAAAGCTGACCAATAAGGCCACCCTGTGGTATGTGCCCCTGTCGCTGAAGAATGTG GACAAGGTCCTCGAGGTGCCTCCTGTTGTGTATTCCCGGCAGGAGCAGGAGGAGGAGGGC CGGAAGCGGTATGAAGCCCAGAAGCTGGAGCGCATGGAGACCAAGTGGAGGAACGGGGAC ATCGTCCAGCCAGTCCTCAACCCAGAGCCGAACACTGTCAGCTACAGCCAGTCCAGCTTG ATCCACCTGGTGGGGCCTTCAGACTGCACCCTGCACGGCTTTGTGCACGGAGGTGTGACC ATGAAGCTCATGGATGAGGTCGCCGGGATCGTGGCTGCACGCCACTGCAAGACCAACATC GTCACAGCTTCCGTGGACGCCATTAATTTTCATGACAAGATCAGAAAAGGCTGCGTCATC ACCATCTCGGGACGCATGACCTTCACGAGCAATAAGTCCATGGAGATCGAGGTGTTGGTG GACGCCGACCCTGTTGTGGACAGCTCTCAGAAGCGCTACCGGGCCGCCAGTGCCTTCTTC ACCTACGTGTCGCTGAGCCAGGAAGGCAGGTCGCTGCCTGTGCCCCAGCTGGTGCCCGAG ACCGAGGACGAGAAGAAGCGCTTTGAGGAAGGCAAAGGGCGGTACCTGCAGATGAAGGCG AAGCGACAGGGCCACGCGGAGCCTCAGCCC |
Restriction Sites | Please inquire |
ACCN | NM_007274 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007274.3, NP_009205.3 |
RefSeq Size | 1814 bp |
RefSeq ORF | 1113 bp |
Locus ID | 11332 |
UniProt ID | O00154 |
Domains | 4HBT |
Protein Pathways | Biosynthesis of unsaturated fatty acids |
Gene Summary | This gene encodes a member of the acyl coenzyme family. The encoded protein hydrolyzes the CoA thioester of palmitoyl-CoA and other long-chain fatty acids. Decreased expression of this gene may be associated with mesial temporal lobe epilepsy. Alternatively spliced transcript variants encoding distinct isoforms with different subcellular locations have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (hBACHa) differs in the 5' UTR and 5' coding region, compared to variant hBACHb. It encodes isoform hBACHa that has a shorter and distinct N-terminus lacking a mitochondrial targetting sequence, compared to isoform hBACHb. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200200 | ACOT7 (Myc-DDK-tagged)-Human acyl-CoA thioesterase 7 (ACOT7), transcript variant hBACHa |
CNY 3,990.00 |
|
RC200200L3 | Lenti-ORF clone of ACOT7 (Myc-DDK-tagged)-Human acyl-CoA thioesterase 7 (ACOT7), transcript variant hBACHa |
CNY 5,890.00 |
|
RC200200L4 | Lenti-ORF clone of ACOT7 (mGFP-tagged)-Human acyl-CoA thioesterase 7 (ACOT7), transcript variant hBACHa |
CNY 6,424.00 |
|
RG200200 | ACOT7 (tGFP-tagged) - Human acyl-CoA thioesterase 7 (ACOT7), transcript variant hBACHa |
CNY 4,370.00 |
|
SC110261 | ACOT7 (untagged)-Human acyl-CoA thioesterase 7 (ACOT7), transcript variant hBACHa |
CNY 3,656.00 |