Septin 3 (SEPT3) (NM_019106) Human Untagged Clone

CAT#: SC317550

41520 (untagged)-Human septin 3 (SEPT3), transcript variant B



  "NM_019106" in other vectors (5)

CNY 5,700.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SEPT3 mouse monoclonal antibody,clone OTI3H6
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bK250D10.3; SEP3; SEPT3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_019106, the custom clone sequence may differ by one or more nucleotides
ATGTCCAAAGGGCTCCCAGAGACCAGGACGGACGCAGCCATGTCAGAGCTGGTGCCTGAG
CCCAGGCCTAAGCCAGCGGTGCCCATGAAGCCCATGAGCATCAACTCCAACCTGCTGGGC
TACATCGGCATCGACACCATCATCGAGCAGATGCGCAAGAAGACCATGAAGACCGGTTTC
GACTTCAACATCATGGTCGTTGGCCAGAGTGGACTGGGCAAATCAACGCTGGTCAACACG
CTCTTCAAATCCCAAGTGAGCCGCAAGGCCTCCAGCTGGAACCGGGAGGAGAAGATCCCC
AAGACAGTGGAGATCAAAGCTATCGGGCATGTGATAGAGGAAGGCGGTGTCAAAATGAAG
CTGACCGTCATCGACACCCCAGGCTTTGGAGACCAAATCAACAATGAAAACTGCTGGGAG
CCCATTGAGAAGTACATCAATGAGCAGTACGAGAAGTTCCTGAAGGAGGAGGTCAACATC
GCCAGGAAGAAACGCATCCCTGACACTCGTGTCCACTGCTGCCTTTACTTCATCTCTCCC
ACAGGACACTCCTTGCGACCTCTGGATCTTGAGTTCATGAAACACCTCAGCAAGGTTGTG
AACATCATCCCTGTCATTGCTAAGGCTGACACCATGACCCTGGAGGAGAAGTCTGAATTC
AAGCAAAGGGTTCGCAAGGAGCTTGAAGTAAATGGCATTGAATTCTACCCCCAGAAGGAA
TTTGATGAGGATTTGGAGGATAAGACGGAGAATGACAAAATCAGGCAGGAGAGCATGCCT
TTTGCTGTGGTGGGAAGTGACAAGGAGTACCAAGTGAATGGCAAGAGGGTCCTCGGCCGA
AAAACTCCATGGGGGATCATCGAAGTGGAAAACCTCAACCACTGTGAGTTTGCCCTGCTT
CGAGACTTTGTCATCAGGACCCACCTCCAGGACCTCAAGGAAGTGACACACAACATCCAC
TATGAGACTTACAGGGCCAAGCGGCTCAATGACAATGGAGGCCTCCCTCCGGTGAGCGTG
GACACAGAGGAAAGCCACGACAGTAACCCA
Restriction Sites Please inquire     
ACCN NM_019106
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_019106.5, NP_061979.3
RefSeq Size 4656 bp
RefSeq ORF 1053 bp
Locus ID 55964
UniProt ID Q9UH03
Domains GTP_CDC
Gene Summary This gene belongs to the septin family of GTPases. Members of this family are required for cytokinesis. Expression is upregulated by retinoic acid in a human teratocarcinoma cell line. The specific function of this gene has not been determined. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, May 2018]
Transcript Variant: This variant (B) differs in the 5' UTR and coding sequence and in the 3' UTR and coding sequence compared to variant C. The resulting isoform (B) has shorter and distinct N- and C-termini compared to isoform C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...