United States
Germany
Japan
United Kingdom
China
Septin 3 (SEPT3) (NM_019106) Human Untagged Clone
CAT＃: SC317550
41520 (untagged)-Human septin 3 (SEPT3), transcript variant B
CNY 5,700.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bK250D10.3; SEP3; SEPT3 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_019106, the custom clone sequence may differ by one or more nucleotides
ATGTCCAAAGGGCTCCCAGAGACCAGGACGGACGCAGCCATGTCAGAGCTGGTGCCTGAG CCCAGGCCTAAGCCAGCGGTGCCCATGAAGCCCATGAGCATCAACTCCAACCTGCTGGGC TACATCGGCATCGACACCATCATCGAGCAGATGCGCAAGAAGACCATGAAGACCGGTTTC GACTTCAACATCATGGTCGTTGGCCAGAGTGGACTGGGCAAATCAACGCTGGTCAACACG CTCTTCAAATCCCAAGTGAGCCGCAAGGCCTCCAGCTGGAACCGGGAGGAGAAGATCCCC AAGACAGTGGAGATCAAAGCTATCGGGCATGTGATAGAGGAAGGCGGTGTCAAAATGAAG CTGACCGTCATCGACACCCCAGGCTTTGGAGACCAAATCAACAATGAAAACTGCTGGGAG CCCATTGAGAAGTACATCAATGAGCAGTACGAGAAGTTCCTGAAGGAGGAGGTCAACATC GCCAGGAAGAAACGCATCCCTGACACTCGTGTCCACTGCTGCCTTTACTTCATCTCTCCC ACAGGACACTCCTTGCGACCTCTGGATCTTGAGTTCATGAAACACCTCAGCAAGGTTGTG AACATCATCCCTGTCATTGCTAAGGCTGACACCATGACCCTGGAGGAGAAGTCTGAATTC AAGCAAAGGGTTCGCAAGGAGCTTGAAGTAAATGGCATTGAATTCTACCCCCAGAAGGAA TTTGATGAGGATTTGGAGGATAAGACGGAGAATGACAAAATCAGGCAGGAGAGCATGCCT TTTGCTGTGGTGGGAAGTGACAAGGAGTACCAAGTGAATGGCAAGAGGGTCCTCGGCCGA AAAACTCCATGGGGGATCATCGAAGTGGAAAACCTCAACCACTGTGAGTTTGCCCTGCTT CGAGACTTTGTCATCAGGACCCACCTCCAGGACCTCAAGGAAGTGACACACAACATCCAC TATGAGACTTACAGGGCCAAGCGGCTCAATGACAATGGAGGCCTCCCTCCGGTGAGCGTG GACACAGAGGAAAGCCACGACAGTAACCCA |
| Restriction Sites | Please inquire |
| ACCN | NM_019106 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_019106.5, NP_061979.3 |
| RefSeq Size | 4656 bp |
| RefSeq ORF | 1053 bp |
| Locus ID | 55964 |
| UniProt ID | Q9UH03 |
| Domains | GTP_CDC |
| Gene Summary | This gene belongs to the septin family of GTPases. Members of this family are required for cytokinesis. Expression is upregulated by retinoic acid in a human teratocarcinoma cell line. The specific function of this gene has not been determined. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, May 2018] Transcript Variant: This variant (B) differs in the 5' UTR and coding sequence and in the 3' UTR and coding sequence compared to variant C. The resulting isoform (B) has shorter and distinct N- and C-termini compared to isoform C. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215714 | SEPT3 (Myc-DDK-tagged)-Human septin 3 (SEPT3), transcript variant B |
CNY 3,656.00 |
|
| RC215714L3 | Lenti ORF clone of Human septin 3 (SEPT3), transcript variant B, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC215714L4 | Lenti ORF clone of Human septin 3 (SEPT3), transcript variant B, mGFP tagged |
CNY 5,890.00 |
|
| RG215714 | 41520 (tGFP-tagged) - Human septin 3 (SEPT3), transcript variant B |
CNY 5,256.00 |
|
| SC110538 | 41520 (untagged)-Human septin 3 (SEPT3), transcript variant B |
CNY 3,656.00 |
其它Septin 3产品
