RDHE2 (SDR16C5) (NM_138969) Human Untagged Clone

CAT#: SC317463

SDR16C5 (untagged)-Human short chain dehydrogenase/reductase family 16C, member 5 (SDR16C5)



  "NM_138969" in other vectors (5)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SDR16C5 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EPHD-2; RDH#2; RDH-E2; RDHE2; retSDR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317463 representing NM_138969.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTTTCAACCTGCAATCATCAAAGAAACTGTTCATTTTCTTAGGAAAATCACTGTTTAGTCTTCTG
GAGGCTATGATTTTTGCCTTACTCCCAAAGCCACGGAAGAACGTTGCTGGTGAAATAGTCCTCATCACA
GGTGCTGGAAGTGGACTCGGAAGGCTCTTAGCCTTGCAGTTTGCCCGGCTGGGATCTGTTCTTGTTCTC
TGGGATATCAATAAGGAGGGGAATGAGGAAACATGTAAGATGGCTCGGGAAGCTGGAGCCACAAGAGTG
CACGCCTATACCTGCGATTGCAGCCAAAAGGAAGGAGTGTATAGAGTAGCCGACCAGGTTAAAAAAGAA
GTCGGCGATGTTTCCATCCTAATCAACAATGCCGGAATCGTAACAGGCAAAAAGTTCCTTGACTGTCCA
GATGAGCTTATGGAAAAGTCATTTGATGTGAATTTCAAAGCACATTTATGGACTTATAAAGCCTTTCTA
CCTGCTATGATTGCTAATGACCATGGACATTTGGTTTGCATTTCAAGTTCAGCTGGATTAAGTGGAGTA
AATGGGCTGGCAGATTACTGTGCAAGTAAATTTGCAGCCTTTGGGTTTGCTGAATCTGTATTTGTAGAA
ACATTTGTCCAAAAACAAAAGGGGATCAAAACCACGATTGTGTGCCCCTTTTTTATAAAAACTGGAATG
TTTGAAGGTTGTACTACAGGCTGTCCTTCTCTGTTGCCAATTCTGGAACCAAAATATGCAGTTGAAAAA
ATAGTAGAAGCTATTCTACAAGAAAAAATGTACTTGTATATGCCAAAGTTGTTATACTTCATGATGTTT
CTTAAAAGCTTTTTGCCCCTCAAGACAGGACTGCTTATAGCTGACTATTTGGGCATCCTTCATGCAATG
GATGGCTTTGTTGACCAAAAGAAGAAGCTCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_138969
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_138969.3
RefSeq Size 3535 bp
RefSeq ORF 930 bp
Locus ID 195814
UniProt ID Q8N3Y7
Protein Families Druggable Genome
MW 34.1 kDa
Gene Summary This gene encodes a member of the short-chain alcohol dehydrogenase/reductase superfamily of proteins and is involved in the oxidation of retinol to retinaldehyde. The encoded protein is associated with the endoplasmic reticulum and is predicted to contain three transmembrane helices, suggesting that it is an integral membrane protein. It recognizes all-trans-retinol and all-trans-retinaldehyde as substrates and exhibits a strong preference for NAD(+)/NADH as cofactors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region compared to variant 1. It encodes isoform 2, which is shorter than and has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...