HNRNPC (NM_031314) Human Untagged Clone
CAT#: SC317457
HNRNPC (untagged)-Human heterogeneous nuclear ribonucleoprotein C (C1/C2) (HNRNPC), transcript variant 1
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C1; C2; HNRNP; HNRPC; SNRPC |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_031314 edited
ATGGCCAGCAACGTTACCAACAAGACAGATCCTCGCTCCATGAACTCCCGTGTATTCATT GGGAATCTCAACACTCTTGTGGTCAAGAAATCTGATGTGGAGGCAATCTTTTCGAAGTAT GGCAAAATTGTGGGCTGCTCTGTTCATAAGGGCTTTGCCTTCGTTCAGTATGTTAATGAG AGAAATGCCCGGGCTGCTGTAGCAGGAGAGGATGGCAGAATGATTGCTGGCCAGGTTTTA GATATTAACCTGGCTGCAGAGCCAAAAGTGAACCGAGGAAAAGCAGGTGTGAAACGATCT GCAGCGGAGATGTACGGGTCAGTAACAGAACACCCTTCTCCGTCCCCTCTACTCAGCTCC TCTTTTGACTTGGACTATGACTTTCAACGGGACTATTATGATAGGATGTACAGTTACCCA GCACGTGTACCTCCTCCTCCTCCTATTGCTCGGGCTGTAGTGCCCTCGAAACGTCAGCGT GTATCAGGAAACACTTCACGAAGGGGCAAAAGTGGCTTCAATTCTAAGAGTGGACAGCGG GGATCTTCCAAGTCTGGAAAGTTGAAAGGAGATGACCTTCAGGCCATTAAGAAGGAGCTG ACCCAGATAAAACAAAAAGTGGATTCTCTCCTGGAAAACCTGGAAAAAATTGAAAAGGAA CAGAGCAAACAAGCAGTAGAGATGAAGAATGATAAGTCAGAAGAGGAGCAGAGCAGCAGC TCCGTGAAGAAAGATGAGACTAATGTGAAGATGGAGTCTGAGGGGGGTGCAGATGACTCT GCTGAGGAGGGGGACCTACTGGATGATGATGATAATGAAGATCGGGGGGATGACCAGCTG GAGTTGATCAAGGATGATGAAAAAGAGGCTGAGGAAGGAGAGGATGACAGAGACAGCGCC AATGGCGAGGATGACTCTTAA |
Restriction Sites | NotI-NotI |
ACCN | NM_031314 |
Insert Size | 2000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_031314.2, NP_112604.2 |
RefSeq Size | 3252 bp |
RefSeq ORF | 921 bp |
Locus ID | 3183 |
UniProt ID | P07910 |
Domains | RRM |
Protein Pathways | Spliceosome |
Gene Summary | This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene can act as a tetramer and is involved in the assembly of 40S hnRNP particles. Multiple transcript variants encoding at least two different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a, also known as isoform C2). Variants 1 and 3 both encode isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215956 | HNRNPC (Myc-DDK-tagged)-Human heterogeneous nuclear ribonucleoprotein C (C1/C2) (HNRNPC), transcript variant 1 |
CNY 2,400.00 |
|
RC215956L1 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein C (C1/C2) (HNRNPC), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC215956L2 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein C (C1/C2) (HNRNPC), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC215956L3 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein C (C1/C2) (HNRNPC), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215956L4 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein C (C1/C2) (HNRNPC), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG215956 | HNRNPC (tGFP-tagged) - Human heterogeneous nuclear ribonucleoprotein C (C1/C2) (HNRNPC), transcript variant 1 |
CNY 4,370.00 |
|
SC107814 | HNRNPC (untagged)-Human heterogeneous nuclear ribonucleoprotein C (C1/C2) (HNRNPC), transcript variant 1 |
CNY 7,552.00 |