MSX1 (NM_002448) Human Untagged Clone

CAT#: SC317449

MSX1 (untagged)-Human msh homeobox 1 (MSX1)



  "NM_002448" in other vectors (7)

CNY 6,270.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal MSX1 Antibody (Center)
    • 400 ul

CNY 6,160.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ECTD3; HOX7; HYD1; STHAG1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317449 representing NM_002448.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCCGGCTGCTGACATGACTTCTTTGCCACTCGGTGTCAAAGTGGAGGACTCCGCCTTCGGCAAG
CCGGCGGGGGGAGGCGCGGGCCAGGCCCCCAGCGCCGCCGCGGCCACGGCAGCCGCCATGGGCGCGGAC
GAGGAGGGGGCCAAGCCCAAAGTGTCCCCTTCGCTCCTGCCCTTCAGCGTGGAGGCGCTCATGGCCGAC
CACAGGAAGCCGGGGGCCAAGGAGAGCGCCCTGGCGCCCTCCGAGGGCGTGCAGGCGGCGGGTGGCTCG
GCGCAGCCACTGGGCGTCCCGCCGGGGTCGCTGGGAGCCCCGGACGCGCCCTCTTCGCCGCGGCCGCTC
GGCCATTTCTCGGTGGGGGGACTCCTCAAGCTGCCAGAAGATGCGCTCGTCAAAGCCGAGAGCCCCGAG
AAGCCCGAGAGGACCCCGTGGATGCAGAGCCCCCGCTTCTCCCCGCCGCCGGCCAGGCGGCTGAGCCCC
CCAGCCTGCACCCTCCGCAAACACAAGACGAACCGTAAGCCGCGGACGCCCTTCACCACCGCGCAGCTG
CTGGCGCTGGAGCGCAAGTTCCGCCAGAAGCAGTACCTGTCCATCGCCGAGCGCGCGGAGTTCTCCAGC
TCGCTCAGCCTCACTGAGACGCAGGTGAAGATATGGTTCCAGAACCGCCGCGCCAAGGCAAAGAGACTA
CAAGAGGCAGAGCTGGAGAAGCTGAAGATGGCCGCCAAGCCCATGCTGCCACCGGCTGCCTTCGGCCTC
TCCTTCCCTCTCGGCGGCCCCGCAGCTGTAGCGGCCGCGGCGGGTGCCTCGCTCTACGGTGCCTCTGGC
CCCTTCCAGCGCGCCGCGCTGCCTGTGGCGCCCGTGGGACTCTACACGGCCCATGTGGGCTACAGCATG
TACCACCTGACATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_002448
Insert Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002448.3
RefSeq Size 1940 bp
RefSeq ORF 912 bp
Locus ID 4487
UniProt ID P28360
Domains homeobox
Protein Families Druggable Genome, Transcription Factors
MW 31.5 kDa
Gene Summary This gene encodes a member of the muscle segment homeobox gene family. The encoded protein functions as a transcriptional repressor during embryogenesis through interactions with components of the core transcription complex and other homeoproteins. It may also have roles in limb-pattern formation, craniofacial development, particularly odontogenesis, and tumor growth inhibition. Mutations in this gene, which was once known as homeobox 7, have been associated with nonsyndromic cleft lip with or without cleft palate 5, Witkop syndrome, Wolf-Hirschom syndrome, and autosomoal dominant hypodontia. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...