United States
Germany
Japan
United Kingdom
China
Claudin 23 (CLDN23) (NM_194284) Human Untagged Clone
CAT＃: SC317428
CLDN23 (untagged)-Human claudin 23 (CLDN23)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CLDNL; hCG1646163 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_194284 edited
ATGCGGACGCCGGTGGTGATGACGCTGGGCATGGTGTTGGCGCCCTGCGGGCTCCTGCTC AACCTGACCGGCACCCTGGCGCCCGGCTGGCGGCTGGTGAAGGGCTTCCTGAACCAGCCA GTGGACGTGGAGTTGTACCAGGGCCTGTGGGACATGTGTCGCGAGCAGAGCAGCCGCGAG CGCGAGTGCGGCCAGACGGACCAGTGGGGCTACTTCGAGGCCCAGCCCGTGCTGGTGGCG CGGGCACTCATGGTCACCTCGCTGGCCGCCACGGTCCTGGGGCTTCTGCTGGCGTCGCTG GGCGTGCGCTGCTGGCAGGACGAGCCCAACTTCGTGCTGGCAGGGCTCTCGGGCGTCGTG CTCTTCGTCGCTGGCCTCCTCGGCCTCATCCCGGTGTCCTGGTACAACCACTTCTTGGGG GACCGCGACGTGCTGCCCGCCCCGGCCAGCCCGGTCACGGTGCAGGTCAGCTACAGCCTG GTCCTGGGCTACCTGGGCAGCTGCCTCCTGCTGCTGGGCGGCTTCTCGCTGGCGCTCAGC TTCGCGCCCTGGTGCGACGAGCGTTGTCGCCGCCGCCGCAAGGGACCCTCCGCCGGGCCT CGCCGCAGCAGCGTCAGCACCATCCAAGTGGAGTGGCCCGAGCCCGACCTGGCGCCCGCC ATCAAGTACTACAGCGACGGCCAGCACCGACCGCCGCCTGCCCAGCACCGCAAGCCCAAG CCCAAGCCCAAGGTCGGCTTCCCCATGCCGCGGCCGCGGCCCAAGGCCTACACCAACTCG GTGGACGTCCTCGACGGGGAGGGGTGGGAGTCCCAGGACGCTCCCTCGTGCAGCACCCAC CCCTGCGACAGCTCGCTGCCCTGCGACTCCGACCTCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_194284 |
| Insert Size | 2200 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_194284.2, NP_919260.2 |
| RefSeq Size | 1972 bp |
| RefSeq ORF | 879 bp |
| Locus ID | 137075 |
| UniProt ID | Q96B33 |
| Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction |
| Gene Summary | This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is expressed in germinal center B-cells, placenta and stomach as well as in colon tumor. This gene is down-regulated in intestinal type gastric cancer. [provided by RefSeq, Aug 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221232 | CLDN23 (Myc-DDK-tagged)-Human claudin 23 (CLDN23) |
CNY 3,600.00 |
|
| RC221232L1 | Lenti ORF clone of Human claudin 23 (CLDN23), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC221232L2 | Lenti ORF clone of Human claudin 23 (CLDN23), mGFP tagged |
CNY 6,000.00 |
|
| RC221232L3 | Lenti ORF clone of Human claudin 23 (CLDN23), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC221232L4 | Lenti ORF clone of Human claudin 23 (CLDN23), mGFP tagged |
CNY 5,890.00 |
|
| RG221232 | CLDN23 (tGFP-tagged) - Human claudin 23 (CLDN23) |
CNY 5,200.00 |
其它Claudin 23产品
