United States
Germany
Japan
United Kingdom
China
MOBKL2C (MOB3C) (NM_145279) Human Untagged Clone
CAT＃: SC317388
MOB3C (untagged)-Human MOB1, Mps One Binder kinase activator-like 2C (yeast) (MOBKL2C), transcript variant 1
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MOB1E; MOBKL2C |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_145279, the custom clone sequence may differ by one or more nucleotides
ATGAAGCGCAGAAATCTCTTTGCTCTGGAAACTGGGGTCCCACCCTGGGGACTTCTTTGG GTGAGAAGTCGAAGAGTCGGGATGGATGAGATGACCTTTCACATCTGGTATCCTCAGGTC CGAGCCCCTGGACAGCAGCCCCAGGCCCAGCTGGCCATGGCCCTGTGCCTGAAGCAGGTG TTCGCCAAGGACAAGACGTTCCGGCCGCGGAAGCGCTTTGAGCCGGGCACACAGCGCTTT GAGCTGTACAAGAAGGCACAGGCCTCTCTCAAGTCGGGCCTGGACCTGCGCAGTGTGGTG AGGCTACCACCCGGGGAGAACATCGACGACTGGATCGCCGTGCACGTGGTGGACTTCTTC AACCGCATCAACCTCATCTACGGCACTATGGCGGAGCGCTGCAGTGAGACCAGCTGCCCG GTCATGGCCGGCGGGCCCCGCTACGAGTACCGCTGGCAGGACGAGCGCCAGTACCGGCGG CCCGCCAAGCTCTCTGCGCCGCGCTATATGGCATTGCTCATGGACTGGATCGAAGGCCTC ATCAACGACGAAGAGGTCTTTCCCACGCGTGTTGGAGTTCCCTTCCCTAAGAACTTCCAG CAGGTCTGCACCAAGATCCTGACCCGCCTCTTCCGAGTCTTTGTCCATGTCTACATCCAC CACTTCGATAGCATCCTCAGCATGGGGGCAGAGGCGCACGTCAACACCTGCTACAAGCAC TTCTACTACTTCATCCGCGAGTTCAGTCTGGTGGACCAGCGGGAGCTGGAGCCACTGAGG GAGATGACAGAGCGGATCTGCCAC |
| Restriction Sites | Please inquire |
| ACCN | NM_145279 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_145279.4, NP_660322.2 |
| RefSeq Size | 2804 bp |
| RefSeq ORF | 807 bp |
| Locus ID | 148932 |
| UniProt ID | Q70IA8 |
| Domains | Mob1_phocein |
| Gene Summary | The protein encoded by this gene is similar to the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214578 | MOB3C (Myc-DDK-tagged)-Human MOB1, Mps One Binder kinase activator-like 2C (yeast) (MOBKL2C), transcript variant 1 |
CNY 3,990.00 |
|
| RC214578L3 | Lenti-ORF clone of MOB3C (Myc-DDK-tagged)-Human MOB1, Mps One Binder kinase activator-like 2C (yeast) (MOBKL2C), transcript variant 1 |
CNY 5,890.00 |
|
| RC214578L4 | Lenti-ORF clone of MOB3C (mGFP-tagged)-Human MOB1, Mps One Binder kinase activator-like 2C (yeast) (MOBKL2C), transcript variant 1 |
CNY 5,890.00 |
|
| RG214578 | MOB3C (tGFP-tagged) - Human MOB1, Mps One Binder kinase activator-like 2C (yeast) (MOBKL2C), transcript variant 1 |
CNY 4,370.00 |
|
| SC111871 | MOB3C (untagged)-Human MOB1, Mps One Binder kinase activator-like 2C (yeast) (MOBKL2C), transcript variant 1 |
CNY 2,400.00 |
其它MOBKL2C产品
