BARX1 (NM_021570) Human Untagged Clone

CAT#: SC317363

BARX1 (untagged)-Human BARX homeobox 1 (BARX1)



  "NM_021570" in other vectors (7)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


BARX1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_021570, the custom clone sequence may differ by one or more nucleotides
ATGCAGCGGCCGGGGGAGCCGGGCGCCGCGCGCTTCGGCCCGCCCGAGGGCTGCGCGGAC
CACCGGCCGCACCGCTATCGCAGCTTCATGATTGAGGAGATCCTCACGGAGCCACCCGGG
CCCAAGGGCGCCGCGCCCGCAGCCGCCGCTGCCGCGGCGGGCGAGCTGCTGAAGTTCGGC
GTGCAGGCGCTGCTGGCGGCGCGGCCCTTCCACAGCCACCTGGCCGTGCTGAAGGCCGAG
CAGGCGGCGGTGTTCAAGTTCCCACTGGCGCCGCTGGGCTGTTCAGGGCTGAGCTCTGCG
TTGCTGGCGGCAGGGCCCGGGCTGCCCGGCGCCGCGGGTGCGCCACACCTGCCGCTCGAG
TTGCAGCTCCGCGGGAAGCTGGAGGCGGCAGGCCCTGGGGAGCCAGGCACCAAAGCCAAG
AAGGGGCGTCGGAGCCGCACTGTGTTCACCGAGCTGCAGCTGATGGGCCTGGAGAAACGC
TTCGAGAAGCAGAAGTACCTTTCCACGCCGGACAGAATAGATCTTGCTGAGTCCCTGGGC
CTGAGCCAGTTGCAGGTGAAGACGTGGTACCAGAATCGGAGGATGAAGTGGAAGAAAATA
GTGCTGCAGGGCGGCGGCCTGGAGTCTCCCACCAAGCCCAAGGGGCGGCCCAAGAAGAAC
TCAATTCCAACGAGCGAGCAGCTTACTGAGCAGGAGCGCGCCAAGGATGCAGAGAAACCG
GCGGAGGTGCCGGGCGAGCCCAGCGACAGGAGCCGCGAGGAC
Restriction Sites Please inquire     
ACCN NM_021570
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021570.3, NP_067545.3
RefSeq Size 1498 bp
RefSeq ORF 765 bp
Locus ID 56033
UniProt ID Q9HBU1
Protein Families Transcription Factors
Gene Summary This gene encodes a member of the Bar subclass of homeobox transcription factors. Studies of the mouse and chick homolog suggest the encoded protein may play a role in developing teeth and craniofacial mesenchyme of neural crest origin. The protein may also be associated with differentiation of stomach epithelia. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...