VAPA (NM_194434) Human Untagged Clone

CAT#: SC317355

VAPA (untagged)-Human VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa (VAPA), transcript variant 2



  "NM_194434" in other vectors (8)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
VAPA mouse monoclonal antibody, clone OTI10E10 (formerly 10E10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hVAP-33; VAMP-A; VAP-33; VAP-A; VAP33
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317355 representing NM_194434.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGTCCGCCTCAGGGGCCATGGCGAAGCACGAGCAGATCCTGGTCCTCGATCCGCCCACAGACCTC
AAATTCAAAGGCCCCTTCACAGATGTAGTCACTACAAATCTTAAATTGCGAAATCCATCGGATAGAAAA
GTGTGTTTCAAAGTGAAGACTACAGCACCTCGCCGGTACTGTGTGAGGCCCAACAGTGGAATTATTGAC
CCAGGGTCAACTGTGACTGTTTCAGTAATGCTACAGCCCTTTGACTATGATCCGAATGAAAAGAGTAAA
CACAAGTTTATGGTACAGACAATTTTTGCTCCACCAAACACTTCAGATATGGAAGCTGTGTGGAAAGAG
GCAAAACCTGATGAATTAATGGATTCCAAATTGAGATGCGTATTTGAAATGCCCAATGAAAATGATAAA
TTGAATGATATGGAACCTAGCAAAGCTGTTCCACTGAATGCATCTAAGCAAGATGGACCTATGCCAAAA
CCACACAGTGTTTCACTTAATGATACCGAAACAAGGAAACTAATGGAAGAGTGTAAAAGACTTCAGGGA
GAAATGATGAAGCTATCAGAAGAAAATCGGCACCTGAGAGATGAAGGTTTAAGGCTCAGAAAGGTAGCA
CATTCGGATAAACCTGGATCAACCTCAACTGCATCCTTCAGAGATAATGTCACCAGTCCTCTTCCTTCA
CTTCTTGTTGTAATTGCAGCCATTTTCATTGGATTCTTTCTAGGGAAATTCATCTTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_194434
Insert Size 750 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_194434.2
RefSeq Size 6859 bp
RefSeq ORF 750 bp
Locus ID 9218
UniProt ID Q9P0L0
Protein Families Transmembrane
Protein Pathways Tight junction
MW 27.9 kDa
Gene Summary The protein encoded by this gene is a type IV membrane protein. It is present in the plasma membrane and intracellular vesicles. It may also be associated with the cytoskeleton. This protein may function in vesicle trafficking, membrane fusion, protein complex assembly and cell motility. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...