VAPA (NM_194434) Human Untagged Clone
CAT#: SC317355
VAPA (untagged)-Human VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa (VAPA), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hVAP-33; VAMP-A; VAP-33; VAP-A; VAP33 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317355 representing NM_194434.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGTCCGCCTCAGGGGCCATGGCGAAGCACGAGCAGATCCTGGTCCTCGATCCGCCCACAGACCTC AAATTCAAAGGCCCCTTCACAGATGTAGTCACTACAAATCTTAAATTGCGAAATCCATCGGATAGAAAA GTGTGTTTCAAAGTGAAGACTACAGCACCTCGCCGGTACTGTGTGAGGCCCAACAGTGGAATTATTGAC CCAGGGTCAACTGTGACTGTTTCAGTAATGCTACAGCCCTTTGACTATGATCCGAATGAAAAGAGTAAA CACAAGTTTATGGTACAGACAATTTTTGCTCCACCAAACACTTCAGATATGGAAGCTGTGTGGAAAGAG GCAAAACCTGATGAATTAATGGATTCCAAATTGAGATGCGTATTTGAAATGCCCAATGAAAATGATAAA TTGAATGATATGGAACCTAGCAAAGCTGTTCCACTGAATGCATCTAAGCAAGATGGACCTATGCCAAAA CCACACAGTGTTTCACTTAATGATACCGAAACAAGGAAACTAATGGAAGAGTGTAAAAGACTTCAGGGA GAAATGATGAAGCTATCAGAAGAAAATCGGCACCTGAGAGATGAAGGTTTAAGGCTCAGAAAGGTAGCA CATTCGGATAAACCTGGATCAACCTCAACTGCATCCTTCAGAGATAATGTCACCAGTCCTCTTCCTTCA CTTCTTGTTGTAATTGCAGCCATTTTCATTGGATTCTTTCTAGGGAAATTCATCTTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_194434 |
Insert Size | 750 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_194434.2 |
RefSeq Size | 6859 bp |
RefSeq ORF | 750 bp |
Locus ID | 9218 |
UniProt ID | Q9P0L0 |
Protein Families | Transmembrane |
Protein Pathways | Tight junction |
MW | 27.9 kDa |
Gene Summary | The protein encoded by this gene is a type IV membrane protein. It is present in the plasma membrane and intracellular vesicles. It may also be associated with the cytoskeleton. This protein may function in vesicle trafficking, membrane fusion, protein complex assembly and cell motility. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201164 | VAPA (Myc-DDK-tagged)-Human VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa (VAPA), transcript variant 2 |
CNY 2,400.00 |
|
RC201164L1 | Lenti ORF clone of Human VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa (VAPA), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC201164L2 | Lenti ORF clone of Human VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa (VAPA), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC201164L3 | Lenti ORF clone of Human VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa (VAPA), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC201164L4 | Lenti ORF clone of Human VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa (VAPA), transcript variant 2, mGFP tagged |
CNY 4,800.00 |
|
RG201164 | VAPA (tGFP-tagged) - Human VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa (VAPA), transcript variant 2 |
CNY 4,000.00 |
|
SC110037 | VAPA (untagged)-Human VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa (VAPA), transcript variant 2 |
CNY 2,400.00 |
|
SC320705 | VAPA (untagged)-Human VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa (VAPA), transcript variant 2 |
CNY 2,400.00 |